Products for Research Use Only

CD82 Recombinant Protein

CAT: 0384-NCP0231-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0231-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
CD82 (KAI1) belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . CD82 does not have enzymatic activity and appears to function by regulating the trafficking of other proteins and organization of the cell membrane. CD82 was originally described as a costimulator for T cells that directly associates with CD4 and CD8, and was subsequently identified during a screen as a metastasis suppressor in prostate cancer. CD82 has since been found to act as a metastasis suppressor in a variety of cancers, and its downregulation is associated with poor prognosis in research studies. CD82 suppresses metastasis through multiple mechanisms including inhibition of cell motility and invasion by modulating c-Met and the urokinase plasminogen activator surface receptor (uPAR), as well as promotion of homotypic cell-cell adhesion by stabilizing interactions between E-cadherin and β-catenin.
CAS Number
9000-83-3
Swiss Prot
P27701
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~15kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GGTAAACTGAAACAGGAAATGGGCGGTATTGTGACCGAACTGATTCGTGATTATAATAGTAGTCGCGAAGATAGCCTGCAGGATGCCTGGGATTATGTTCAGGCACAGGTGAAATGCTGCGGTTGGGTGAGCTTCTATAATTGGACCGATAATGCCGAACTGATGAATCGCCCGGAAGTGACCTATCCGTGTAGCTGTGAAGTTAAAGGCGAAGAAGATAATAGTCTGAGCGTGCGTAAAGGCTTCTGTGAAGCCCCGGGCAATCGCACCCAGAGTGGCAATCATCCGGAAGATTGGCCGGTGTATCAGGAAGGTTGTATGGAAAAAGTTCAGGCCTGGCTGCAGGAAAATCTG