CD8B Recombinant Protein

CAT:
384-NCP0235-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD8B Recombinant Protein - image 1

CD8B Recombinant Protein

  • Background:

    The T cell receptor (TCR) is a heterodimer composed of either a and b or γ and δ chains. CD3 chains and the CD4 or CD8 co-receptors are also required for efficient signal transduction through the TCR. The TCR is expressed on T helper and T cytotoxic cells that can be distinguished by their expression of CD4 and CD8. T helper cells express CD4 proteins and T cytotoxic cells display CD8. CD8 (also designated Leu 2 or T8), a cell surface glycoprotein, is a two chain complex (aa or ab) receptor that binds class I MHC molecules presented by the antigen-presenting cell (APC) . A primary function of CD8 is to facilitate antigen recognition by the TCR and to strengthen the avidity of the TCR-antigen interactions. An additional role for CD8-expressing T cells may be to maintain low levels of HIV expression.
  • Swiss Prot:

    P10966
  • Modification Site:

    NdeI-XhoI
  • Expression System:

    Pet-22b (+)
  • Tag:

    His-tag
  • Purity:

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility:

    PBS, 4M Urea, PH7.4
  • Molecular Weight:

    ~18kDa
  • Storage Conditions:

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes:

    For research use only, not for use in diagnostic procedure.
  • Host or Source:

    E.coli
  • CAS Number:

    9000-83-3
  • AA Sequence:

    CTGCAGCAGACCCCGGCTTATATTAAAGTTCAGACCAATAAAATGGTGATGCTGAGCTGCGAAGCAAAAATTAGTCTGAGCAATATGCGCATCTATTGGCTGCGCCAGCGCCAGGCACCGAGTAGTGATAGTCATCATGAATTCCTGGCCCTGTGGGATAGCGCCAAAGGTACCATTCATGGCGAAGAAGTGGAACAGGAAAAAATTGCCGTGTTCCGTGATGCCAGCCGCTTCATTCTGAATCTGACCAGCGTTAAACCGGAAGATAGTGGCATCTACTTCTGCATGATTGTTGGCAGTCCGGAACTGACCTTCGGCAAAGGTACCCAGCTGAGCGTTGTTGACTTCCTGCCGACCACCGCACAGCCGACCAAAAAAAGTACCCTGAAAAAACGTGTGTGCCGCCTGCCGCGCCCGGAAACACAGAAAGGTCCGCTGTGCAGTCCG