CD8B Recombinant Protein

• Background:

  The T cell receptor (TCR) is a heterodimer composed of either a and b or γ and δ chains. CD3 chains and the CD4 or CD8 co-receptors are also required for efficient signal transduction through the TCR. The TCR is expressed on T helper and T cytotoxic cells that can be distinguished by their expression of CD4 and CD8. T helper cells express CD4 proteins and T cytotoxic cells display CD8. CD8 (also designated Leu 2 or T8), a cell surface glycoprotein, is a two chain complex (aa or ab) receptor that binds class I MHC molecules presented by the antigen-presenting cell (APC) . A primary function of CD8 is to facilitate antigen recognition by the TCR and to strengthen the avidity of the TCR-antigen interactions. An additional role for CD8-expressing T cells may be to maintain low levels of HIV expression.

• Swiss Prot:

  P10966

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~18kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  CTGCAGCAGACCCCGGCTTATATTAAAGTTCAGACCAATAAAATGGTGATGCTGAGCTGCGAAGCAAAAATTAGTCTGAGCAATATGCGCATCTATTGGCTGCGCCAGCGCCAGGCACCGAGTAGTGATAGTCATCATGAATTCCTGGCCCTGTGGGATAGCGCCAAAGGTACCATTCATGGCGAAGAAGTGGAACAGGAAAAAATTGCCGTGTTCCGTGATGCCAGCCGCTTCATTCTGAATCTGACCAGCGTTAAACCGGAAGATAGTGGCATCTACTTCTGCATGATTGTTGGCAGTCCGGAACTGACCTTCGGCAAAGGTACCCAGCTGAGCGTTGTTGACTTCCTGCCGACCACCGCACAGCCGACCAAAAAAAGTACCCTGAAAAAACGTGTGTGCCGCCTGCCGCGCCCGGAAACACAGAAAGGTCCGCTGTGCAGTCCG