CD80 Recombinant Protein

• Background :

  CD80 (B7-1, BB1) and CD86 (B7-2, B70) are members of the B7 family of cell surface ligands that regulate T cell activation and immune responses. CD80 is expressed on activated antigen presenting cells, including dendritic cells, B cells, monocytes, and macrophages. CD86 is expressed on resting monocytes, dendritic cells, activated B lymphocytes, and can be further upregulated in the presence of inflammation. CD80 and CD86 are ligands for CD28, which functions as a T cell costimulatory receptor. Interaction of CD28 with CD80 or CD86 provides the second signal required for naïve T cell activation, T cell proliferation, and acquisition of effector functions. Alternatively, CD80 and CD86 also act as ligands to CTLA-4, which results in the downregulation of T cell activity.

• Swiss Prot :

  P33681

• Modification Site :

  NdeI-XhoI

• Expression System :

  Pet-22b (+)

• Tag :

  His-tag

• Purity :

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility :

  PBS, 4M Urea, PH7.4

• Molecular Weight :

  ~23kDa

• Storage Conditions :

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes :

  For research use only, not for use in diagnostic procedure.

• Host or Source :

  E.coli

• CAS Number :

  9000-83-3

• AA Sequence :

  GTTATCCATGTTACCAAAGAAGTGAAAGAAGTTGCCACCCTGAGTTGCGGTCATAATGTGAGTGTTGAAGAACTGGCACAGACCCGTATCTATTGGCAGAAAGAAAAAAAAATGGTGCTGACCATGATGAGCGGCGATATGAATATCTGGCCGGAATATAAAAATCGTACCATCTTCGATATCACCAATAATCTGAGTATTGTTATCCTGGCACTGCGTCCGAGTGATGAAGGTACCTATGAATGTGTTGTGCTGAAATATGAAAAGGATGCCTTCAAACGTGAACATCTGGCAGAAGTTACCCTGAGTGTGAAAGCAGACTTCCCGACCCCGAGCATTAGCGACTTCGAAATTCCGACCAGTAATATTCGTCGTATTATCTGTAGCACCAGTGGTGGCTTCCCGGAACCGCATCTGAGCTGGCTGGAAAATGGTGAAGAACTGAATGCCATTAATACCACCGTGAGCCAGGATCCGGAAACCGAACTGTATGCAGTGAGTAGTAAACTGGACTTCAATATGACCACCAATCATAGCTTCATGTGTCTGATTAAATACGGTCATCTGCGCGTGAATCAGACCTTCAATTGGAATACCACCAAACAGGAACACTTCCCGGATAAT