CD80 Recombinant Protein
- Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
- Dry Ice Shipment: No


CD80 Recombinant Protein
Background:
CD80 (B7-1, BB1) and CD86 (B7-2, B70) are members of the B7 family of cell surface ligands that regulate T cell activation and immune responses. CD80 is expressed on activated antigen presenting cells, including dendritic cells, B cells, monocytes, and macrophages. CD86 is expressed on resting monocytes, dendritic cells, activated B lymphocytes, and can be further upregulated in the presence of inflammation. CD80 and CD86 are ligands for CD28, which functions as a T cell costimulatory receptor. Interaction of CD28 with CD80 or CD86 provides the second signal required for naïve T cell activation, T cell proliferation, and acquisition of effector functions. Alternatively, CD80 and CD86 also act as ligands to CTLA-4, which results in the downregulation of T cell activity.Swiss Prot:
P33681Modification Site:
NdeI-XhoIExpression System:
Pet-22b (+)Tag:
His-tagPurity:
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .Solubility:
PBS, 4M Urea, PH7.4Molecular Weight:
~23kDaStorage Conditions:
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.Notes:
For research use only, not for use in diagnostic procedure.Host or Source:
E.coliCAS Number:
9000-83-3AA Sequence:
GTTATCCATGTTACCAAAGAAGTGAAAGAAGTTGCCACCCTGAGTTGCGGTCATAATGTGAGTGTTGAAGAACTGGCACAGACCCGTATCTATTGGCAGAAAGAAAAAAAAATGGTGCTGACCATGATGAGCGGCGATATGAATATCTGGCCGGAATATAAAAATCGTACCATCTTCGATATCACCAATAATCTGAGTATTGTTATCCTGGCACTGCGTCCGAGTGATGAAGGTACCTATGAATGTGTTGTGCTGAAATATGAAAAGGATGCCTTCAAACGTGAACATCTGGCAGAAGTTACCCTGAGTGTGAAAGCAGACTTCCCGACCCCGAGCATTAGCGACTTCGAAATTCCGACCAGTAATATTCGTCGTATTATCTGTAGCACCAGTGGTGGCTTCCCGGAACCGCATCTGAGCTGGCTGGAAAATGGTGAAGAACTGAATGCCATTAATACCACCGTGAGCCAGGATCCGGAAACCGAACTGTATGCAGTGAGTAGTAAACTGGACTTCAATATGACCACCAATCATAGCTTCATGTGTCTGATTAAATACGGTCATCTGCGCGTGAATCAGACCTTCAATTGGAATACCACCAAACAGGAACACTTCCCGGATAAT
