CD8A Recombinant Protein

CAT:
384-NCP0234-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD8A Recombinant Protein - image 1

CD8A Recombinant Protein

  • Background :

    Cluster of Differentiation 8 (CD8) is a disulphide-linked heterodimer consisting of the unrelated α and β subunits. Each subunit is a glycoprotein composed of a single extracellular Ig-like domain, a polypeptide linker, a transmembrane part and a short cytoplasmic tail. On T cells, CD8 is the coreceptor for the T cell receptor (TCR), and these two distinct structures recognize the Antigen–Major Histocompatibility Complex (MHC) . Specifically, the Ig-like domain of CD8α interacts with the α3-domain of the MHC class I molecule. CD8 ensures specificity of the TCR–antigen interaction, prolongs the contact between the T cell and the antigen presenting cell, and the α chain recruits the tyrosine kinase Lck, which is essential for T cell activation.
  • Swiss Prot :

    P01732
  • Modification Site :

    NdeI-XhoI
  • Expression System :

    Pet-22b (+)
  • Tag :

    His-tag
  • Purity :

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility :

    PBS, 4M Urea, PH7.4
  • Molecular Weight :

    ~18kDa
  • Storage Conditions :

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes :

    For research use only, not for use in diagnostic procedure.
  • Host or Source :

    E.coli
  • CAS Number :

    9000-83-3
  • AA Sequence :

    AGTCAGTTCCGTGTGAGTCCGCTGGATCGTACCTGGAATCTGGGTGAAACCGTTGAACTGAAATGCCAGGTTCTGCTGAGCAATCCGACCAGCGGTTGTAGCTGGCTGTTCCAGCCGCGTGGTGCCGCAGCAAGCCCGACATTCCTGCTGTATCTGAGTCAGAATAAACCGAAAGCCGCAGAAGGCCTGGATACCCAGCGCTTCAGTGGTAAACGCCTGGGCGATACCTTCGTGCTGACCCTGAGCGACTTCCGTCGTGAAAATGAAGGCTATTACTTCTGCAGCGCACTGAGTAATAGTATTATGTACTTCAGCCACTTCGTGCCGGTGTTCCTGCCGGCAAAACCGACCACCACCCCGGCCCCTCGCCCTCCTACACCTGCACCTACCATTGCCAGTCAGCCGCTGAGCCTGCGCCCGGAAGCCTGTCGTCCGGCAGCAGGTGGCGCCGTTCATACCCGCGGTCTGGACTTCGCCTGTGAT

Featured Selection

Popular Products

Discover our most sought-after biotechnology products, trusted by researchers worldwide