CD8A Recombinant Protein

• Background :

  Cluster of Differentiation 8 (CD8) is a disulphide-linked heterodimer consisting of the unrelated α and β subunits. Each subunit is a glycoprotein composed of a single extracellular Ig-like domain, a polypeptide linker, a transmembrane part and a short cytoplasmic tail. On T cells, CD8 is the coreceptor for the T cell receptor (TCR), and these two distinct structures recognize the Antigen–Major Histocompatibility Complex (MHC) . Specifically, the Ig-like domain of CD8α interacts with the α3-domain of the MHC class I molecule. CD8 ensures specificity of the TCR–antigen interaction, prolongs the contact between the T cell and the antigen presenting cell, and the α chain recruits the tyrosine kinase Lck, which is essential for T cell activation.

• Swiss Prot :

  P01732

• Modification Site :

  NdeI-XhoI

• Expression System :

  Pet-22b (+)

• Tag :

  His-tag

• Purity :

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility :

  PBS, 4M Urea, PH7.4

• Molecular Weight :

  ~18kDa

• Storage Conditions :

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes :

  For research use only, not for use in diagnostic procedure.

• Host or Source :

  E.coli

• CAS Number :

  9000-83-3

• AA Sequence :

  AGTCAGTTCCGTGTGAGTCCGCTGGATCGTACCTGGAATCTGGGTGAAACCGTTGAACTGAAATGCCAGGTTCTGCTGAGCAATCCGACCAGCGGTTGTAGCTGGCTGTTCCAGCCGCGTGGTGCCGCAGCAAGCCCGACATTCCTGCTGTATCTGAGTCAGAATAAACCGAAAGCCGCAGAAGGCCTGGATACCCAGCGCTTCAGTGGTAAACGCCTGGGCGATACCTTCGTGCTGACCCTGAGCGACTTCCGTCGTGAAAATGAAGGCTATTACTTCTGCAGCGCACTGAGTAATAGTATTATGTACTTCAGCCACTTCGTGCCGGTGTTCCTGCCGGCAAAACCGACCACCACCCCGGCCCCTCGCCCTCCTACACCTGCACCTACCATTGCCAGTCAGCCGCTGAGCCTGCGCCCGGAAGCCTGTCGTCCGGCAGCAGGTGGCGCCGTTCATACCCGCGGTCTGGACTTCGCCTGTGAT