Products for Research Use Only

CD3G Recombinant Protein

CAT: 0384-NCP0205-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0205-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
The T cell antigen receptor (TCR) recognizes foreign antigens and translates such recognition events into intracellular signals that elicit a change in the cell from a dormant to an activated state. Much of this signaling process can be attributed to a multisubunit complex of proteins that associates directly with the TCR. This complex has been designated CD3 (cluster of differentiation 3) . It is composed of five invariant polypeptide chains that associate to form three dimers: a heterodimer of γ and ε chains (γε), a heterodimer of δ and ε chains (δε) and a homodimer of two ζ chains (ζζ) or a heterodimer of ζ and η chains (ζη) . The ζ and η chains are encoded by the same gene but differ in their carboxyl-terminal ends due to an alternative splicing event. The γ, ε and δ chains each contain a single copy of a conserved immunoreceptor tyrosinebased activation motif (ITAM) . In contrast, the ζ chain contains three consecutive copies of the same motif. Phosphorylated ITAMs act as docking sites for protein kinases such as ZAP-70 and Syk and are also capable of regulating their kinase activity. The crystal structure of the ZAP-70 SH2 domains bound to the ζ chain ITAMs has been solved.
CAS Number
9000-83-3
Swiss Prot
P09693
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~13kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CAGAGTATTAAGGGCAATCATCTGGTGAAAGTGTATGATTATCAGGAAGATGGCAGCGTGCTGCTGACCTGCGATGCCGAAGCCAAAAATATTACCTGGTTCAAAGATGGTAAGATGATTGGCTTCCTGACCGAAGATAAAAAAAAATGGAATCTGGGCAGCAATGCCAAAGATCCGCGCGGTATGTATCAGTGCAAAGGTAGCCAGAATAAAAGCAAACCGCTGCAGGTGTATTATCGCATGTGTCAGAATTGCATTGAACTGAATGCAGCAACCATTAGC