CD3E Recombinant Protein

• Background:

  When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM) . Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.

• Swiss Prot:

  P07766

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~18kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT