CD3E Recombinant Protein

CAT:
384-NCP0204-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD3E Recombinant Protein - image 1

CD3E Recombinant Protein

  • Background:

    When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM) . Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.
  • Swiss Prot:

    P07766
  • Modification Site:

    NdeI-XhoI
  • Expression System:

    Pet-22b (+)
  • Tag:

    His-tag
  • Purity:

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility:

    PBS, 4M Urea, PH7.4
  • Molecular Weight:

    ~18kDa
  • Storage Conditions:

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes:

    For research use only, not for use in diagnostic procedure.
  • Host or Source:

    E.coli
  • CAS Number:

    9000-83-3
  • AA Sequence:

    GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT