Products for Research Use Only
RegisterLogin

CD3E Recombinant Protein

CAT: 0384-NCP0204-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0204-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM) . Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.
CAS Number
9000-83-3
Swiss Prot
P07766
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~18kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT

Related Products

CatalogName
BS80163-01CD3E polyclonal antibody
MB66827-01CD3e monoclonal antibody
MB66179-01CD3e monoclonal antibody
BS62211CD3e polyclonal antibody
BS6859-01CD3E Antigen polyclonal antibody
MB65812-01CD3e Armenian Hamster monoclonal antibody
NCP0205-01CD3G Recombinant Protein
NCP0351-01CD33 Recombinant Protein
NCP0203-01CD37 Recombinant Protein
NCP0206-01CD3Z Recombinant Protein

Alternative Products

CatalogName
PX-P4075-01CD3E Recombinant Protein
MBS8248719-01Recombinant Human CD3E Protein
OPCA04474-100UGCD3E Recombinant Protein (Human)
TP724829CD3E Human Recombinant Protein
RP193955CD3E Recombinant Protein (Rat)
PX-P6337-100Human CD3E recombinant protein
RP122582CD3E Recombinant Protein (Mouse)
TP727837CD3E Cynomolgus Recombinant Protein

Popular Products