Products for Research Use Only

CD37 Recombinant Protein

CAT: 0384-NCP0203-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0203-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Tetra-spans transmembrane family (TSTF) members (CD9, CD37, CD53, CD63, CD81 and CD82) are cell-surface proteins that are characterized by the presence of four hydrophobic, membrane-spanning domains. TSTF members can mediate signal transduction events influencing the regulation of cell development, adhesion, activation, growth and motility. The human CD37 gene maps to chromosome 19p13.3 and encodes a 281 amino acid protein. CD37 is a cell surface glycoprotein that can complex with integrins and other TSTF proteins and may play a role in T cell-B cell interactions. CD37 is strongly expressed on normal and neoplastic mature sIg+ B cells and is detected at low levels on resting and activated T cells, neutrophils, granulocytes and monocytes. Transgenic mouse models elicit no changes in development and cellular composition of lymphoid organs where CD37 is lacking.
CAS Number
9000-83-3
Swiss Prot
P11049
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~16kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CGTGCACAGCTGGAACGCAGTCTGCGCGATGTTGTTGAAAAAACCATTCAGAAATACGGTACCAATCCGGAAGAAACCGCAGCAGAAGAAAGCTGGGATTATGTTCAGTTCCAGCTGCGTTGTTGCGGTTGGCATTATCCGCAGGATTGGTTCCAGGTTCTGATTCTGCGCGGTAATGGTAGCGAAGCACATCGTGTTCCGTGCAGTTGTTATAATCTGAGTGCCACCAATGATAGTACCATTCTGGATAAAGTGATTCTGCCGCAGCTGAGCCGTCTGGGCCATCTGGCACGTAGTCGCCATAGCGCAGATATCTGTGCAGTGCCGGCCGAAAGTCATATCTATCGCGAAGGCTGTGCACAGGGCCTGCAGAAATGGCTGCATAATAAT