Products for Research Use Only
RegisterLogin

CD1E Recombinant Protein

CAT: 0384-NCP0189-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0189-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
The human CD1 family consists of five chromosome 1-localized genes which encode proteins that are involved in mediating the presentation of lipid antigens of microbial or self origin on the surface of immune cells. CD1E, also known as R2 or CD1A, is a 322 amino acid single-pass type I membrane protein that localizes to the lumen of the endoplasmic reticulum, as well as to the Golgi apparatus and contains one Ig-like domain. Expressed in a variety of tissues and on cortical thymocytes, dendritic cells and Langerhans cells, CD1E exists as a heterodimer with β-2-microglobulin and is necessary for the presentation of glycolipid antigens on the cell surface. CD1E is subject to posttranslational mono-ubiquitination and may also be proteolytically cleaved in endosomes to yield a soluble protein. CD1E is present on the surface of some T cell leukemias, suggesting a possible role in tumorigenesis.
CAS Number
9000-83-3
Swiss Prot
P15812
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~30kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GAAGAACAGCTGAGCTTCCGTATGCTGCAGACCAGTAGCTTCGCAAATCATAGCTGGGCACATAGTGAAGGCAGCGGTTGGCTGGGCGATCTGCAGACCCATGGTTGGGATACCGTGCTGGGTACCATTCGCTTCCTGAAACCGTGGAGCCATGGCAACTTCAGTAAACAGGAACTGAAAAATCTGCAGAGTCTGTTCCAGCTGTACTTCCATAGCTTCATTCAGATTGTGCAGGCCAGTGCAGGCCAGTTCCAGCTGGAATATCCGTTCGAAATTCAGATTCTGGCAGGCTGTCGTATGAATGCCCCGCAGATCTTCCTGAATATGGCATATCAGGGTAGCGACTTCCTGAGCTTCCAGGGCATTAGCTGGGAACCGAGCCCGGGTGCAGGCATTCGCGCACAGAATATCTGTAAAGTGCTGAATCGTTATCTGGATATTAAAGAAATCCTGCAGAGCCTGCTGGGTCATACCTGTCCGCGCTTCCTGGCAGGTCTGATGGAAGCAGGTGAAAGCGAACTGAAACGTAAAGTGAAACCGGAAGCATGGCTGAGTTGCGGTCCGAGTCCGGGTCCGGGCCGTCTTCAGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTGATGTGGATGCGTGGTGAACAGGAACAGCGCGGCACCCAGCGCGGCGATGTTCTGCCTAATGCAGATGAAACCTGGTATCTGCGTGCCACCCTGGATGTTGCCGCAGGCGAAGCAGCCGGTCTGAGCTGTCGTGTGAAACATAGCAGTCTGGGTGGTCATGATCTGATTATTCATTGGGGTGGTTAT

Related Products

CatalogName
BS5652-01CD1E polyclonal antibody
BZ16052-01CD1E polyclonal antibody
NCP0186-01CD1B Recombinant Protein
NCP0174-01CD13 Recombinant Protein
NCP0185-01CD1A Recombinant Protein
NCP0178-01CD15 Recombinant Protein
NCP0187-01CD1C Recombinant Protein
NCP0188-01CD1D Recombinant Protein
NBP0571Recombinant Human CD14 protein
NBP0425Recombinant Protein A Protein

Alternative Products

CatalogName
32-3446-20CD1E Recombinant Protein
MBS1561443-01Recombinant Human CD1E protein
RP037894CD1E Recombinant Protein (Human)
NBP2-31691PEPCD1e Recombinant Protein Antigen
PPT-11274Human CD1E Recombinant Protein
PROTP15812CD1E (NM_001185115) Human Recombinant Protein
BLT-00467P-01Human CD1E (T-Cell Surface Glycoprotein Cd1E, Membrane-Associated) - Recombinant Protein
HB783012-01Recombinant Human CD1E Protein, N-His
PR13761Recombinant Human CD1E Protein, C-Fc
GTR18889307-01CD1E protein

Popular Products