CD1D Recombinant Protein

CAT:
384-NCP0188-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD1D Recombinant Protein - image 1

CD1D Recombinant Protein

  • Background :

    The CD1 multigene family encodes five forms of the CD1 T cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Adaptor protein complexes and CD1-associated chaperones control CD1 trafficking and the development and activation of CD1-restricted T cells. CD1D is present on human intestinal epithelial cells (IEC) and exists as a β-2-Microglobulinindependent nonglycosylated form or a β-2-Microglobulin-dependent glycosylated form. The human CD1D gene maps to chromosome 1q23.1 and encodes a 335 amino acid protein that influences normal T cell maturation.
  • Swiss Prot :

    P15813
  • Modification Site :

    NdeI-XhoI
  • Expression System :

    Pet-22b (+)
  • Tag :

    His-tag
  • Purity :

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility :

    PBS, 4M Urea, PH7.4
  • Molecular Weight :

    ~31kDa
  • Storage Conditions :

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes :

    For research use only, not for use in diagnostic procedure.
  • Host or Source :

    E.coli
  • CAS Number :

    9000-83-3
  • AA Sequence :

    GAAGTGCCGCAGCGTCTGTTCCCGCTGCGCTGCCTGCAGATTAGCAGCTTCGCCAATAGCAGCTGGACCCGTACCGATGGTCTGGCCTGGCTGGGTGAACTGCAGACCCATAGTTGGAGTAATGATAGTGATACCGTGCGCAGTCTGAAACCGTGGAGCCAGGGCACCTTCAGTGATCAGCAGTGGGAAACCTTACAGCATATCTTCCGTGTGTATCGTAGCAGCTTCACCCGTGATGTTAAAGAATTCGCAAAAATGCTGCGTCTGAGCTATCCGCTGGAACTGCAGGTTAGCGCAGGTTGCGAAGTTCATCCGGGCAATGCAAGCAATAACTTCTTCCATGTGGCATTCCAGGGCAAAGATATTCTGAGCTTCCAGGGCACCAGCTGGGAACCGACCCAGGAAGCACCGCTGTGGGTTAATCTGGCAATTCAGGTTCTGAATCAGGATAAATGGACCCGCGAAACCGTGCAGTGGCTGCTGAATGGTACCTGCCCGCAGTTCGTGAGCGGCCTGCTGGAAAGTGGCAAAAGTGAACTGAAAAAACAGGTTAAACCGAAAGCCTGGCTGAGCCGCGGTCCGAGTCCGGGTCCTGGTCGTCTGCTGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTTAAATGGATGCGTGGTGAACAGGAACAGCAGGGCACCCAGCCGGGTGATATTCTGCCGAATGCAGATGAAACCTGGTATCTGCGTGCAACCCTGGATGTTGTTGCAGGCGAAGCCGCAGGTCTGAGCTGCCGTGTTAAACATAGTAGCCTGGAAGGTCAGGATATTGTTCTGTATTGGGGTGGCAGTTATACCAGT

Featured Selection

Popular Products

Discover our most sought-after biotechnology products, trusted by researchers worldwide