CD159a Recombinant Protein
- Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
- Dry Ice Shipment: No


CD159a Recombinant Protein
Background :
The activity of natural killer (NK) cells is regulated by members of multiple receptor families that recognize class I MHC molecules, such as the killer cell inhibitory receptor/leukocyte immunoglobulin-like receptor (KIR/LIR) family and the C-type lectin superfamily. The KIR/LIR family includes p91A (also designated pp130 or PIR-B, for paired immunoglobulin-like receptor-B) and p91B (also designated PIR-A) . p91A acts as an inhibitory receptor through interactions with SHP-1, whereas p91B acts as an activating receptor. CD94, NKG2 and Ly-49 are members of the C-type lectin superfamily of type II membrane glycoproteins. CD94 forms heterodimers with NKG2 isoforms on the surface of NK cells, whereas Ly-49 isoforms form homodimers. NKG2-D, expressed on NK cells, gdT cells and CD8+αβ T cells, is a receptor for the stress inducible protein MICA, an antigen frequently expressed in epithelial tumors.CAS Number :
9000-83-3Swiss Prot :
P26715Modification Site :
NdeI-XhoIExpression System :
Pet-22b (+)Tag :
His-tagPurity :
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .Solubility :
PBS, 4M Urea, PH7.4Molecular Weight :
~15kDaStorage Conditions :
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.Notes :
For research use only, not for use in diagnostic procedure.Host or Source :
E.coliAA Sequence :
CCTAGTACCCTGATTCAGCGCCATAATAATAGTAGTCTGAATACCCGCACCCAGAAAGCACGCCATTGCGGCCATTGCCCGGAAGAATGGATTACCTATAGCAATAGCTGTTATTATATCGGCAAAGAACGTCGTACCTGGGAAGAAAGCCTGCTGGCCTGTACCAGTAAAAATAGTAGTCTTCTGAGTATTGACAACGAAGAAGAAATGAAATTCCTGAGTATTATCAGTCCGAGTAGTTGGATTGGTGTGTTCCGCAATAGTAGTCATCATCCGTGGGTTACCATGAATGGTCTGGCCTTCAAACATGAAATTAAAGATAGTGATAACGCGGAACTGAATTGCGCAGTTCTGCAGGTGAATCGCCTGAAAAGTGCCCAGTGTGGTAGTAGCATTATCTATCATTGCAAACATAAGCTG

