CD159a Recombinant Protein

CAT:
384-NCP0284-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD159a Recombinant Protein - image 1

CD159a Recombinant Protein

  • Background :

    The activity of natural killer (NK) cells is regulated by members of multiple receptor families that recognize class I MHC molecules, such as the killer cell inhibitory receptor/leukocyte immunoglobulin-like receptor (KIR/LIR) family and the C-type lectin superfamily. The KIR/LIR family includes p91A (also designated pp130 or PIR-B, for paired immunoglobulin-like receptor-B) and p91B (also designated PIR-A) . p91A acts as an inhibitory receptor through interactions with SHP-1, whereas p91B acts as an activating receptor. CD94, NKG2 and Ly-49 are members of the C-type lectin superfamily of type II membrane glycoproteins. CD94 forms heterodimers with NKG2 isoforms on the surface of NK cells, whereas Ly-49 isoforms form homodimers. NKG2-D, expressed on NK cells, gdT cells and CD8+αβ T cells, is a receptor for the stress inducible protein MICA, an antigen frequently expressed in epithelial tumors.
  • CAS Number :

    9000-83-3
  • Swiss Prot :

    P26715
  • Modification Site :

    NdeI-XhoI
  • Expression System :

    Pet-22b (+)
  • Tag :

    His-tag
  • Purity :

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility :

    PBS, 4M Urea, PH7.4
  • Molecular Weight :

    ~15kDa
  • Storage Conditions :

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes :

    For research use only, not for use in diagnostic procedure.
  • Host or Source :

    E.coli
  • AA Sequence :

    CCTAGTACCCTGATTCAGCGCCATAATAATAGTAGTCTGAATACCCGCACCCAGAAAGCACGCCATTGCGGCCATTGCCCGGAAGAATGGATTACCTATAGCAATAGCTGTTATTATATCGGCAAAGAACGTCGTACCTGGGAAGAAAGCCTGCTGGCCTGTACCAGTAAAAATAGTAGTCTTCTGAGTATTGACAACGAAGAAGAAATGAAATTCCTGAGTATTATCAGTCCGAGTAGTTGGATTGGTGTGTTCCGCAATAGTAGTCATCATCCGTGGGTTACCATGAATGGTCTGGCCTTCAAACATGAAATTAAAGATAGTGATAACGCGGAACTGAATTGCGCAGTTCTGCAGGTGAATCGCCTGAAAAGTGCCCAGTGTGGTAGTAGCATTATCTATCATTGCAAACATAAGCTG

Featured Selection

Popular Products

Discover our most sought-after biotechnology products, trusted by researchers worldwide