Products for Research Use Only
RegisterLogin

CD132 Recombinant Protein

CAT: 0384-NCP0260-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0260-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
The IL-2 receptor is a multicomponent complex consisting of three subunits, a, b and g, each of which is required for high affinity binding of IL-2. The a chain functions primarily in binding IL-2, whereas the b and g chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain high affinity ligand binding cytokine receptors. However, it is now well established that the IL-2R g chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Ra and IL-7Ra respectively, while the common subunit is referred to as gc. Although the common g chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own.There is evidence that the gc chain is also a subunit of IL-13R.
CAS Number
9000-83-3
Swiss Prot
P31785
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~30kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CTGAATACCACCATTCTGACCCCGAATGGTAATGAAGATACCACCGCCGACTTCTTCCTGACCACCATGCCGACCGATAGCCTGAGCGTTAGCACCCTGCCGCTGCCGGAAGTTCAGTGCTTCGTGTTCAATGTGGAATATATGAATTGCACCTGGAATAGTAGCAGCGAACCGCAGCCGACCAATCTGACCCTGCATTATTGGTATAAAAATAGTGATAACGACAAGGTTCAGAAATGCAGCCATTATCTGTTCAGCGAAGAAATTACCAGCGGTTGCCAGCTGCAGAAAAAAGAAATTCATCTGTATCAGACCTTCGTGGTGCAGCTGCAGGATCCGCGTGAACCGCGTCGCCAGGCCACCCAAATGCTGAAACTGCAGAATCTGGTGATTCCGTGGGCACCGGAAAATCTGACCTTACATAAACTGAGTGAAAGCCAGCTGGAACTGAATTGGAATAATCGCTTCCTGAATCATTGCCTGGAACATCTGGTTCAGTATCGTACCGATTGGGATCATAGTTGGACCGAACAGAGCGTTGATTATCGCCATAAATTCAGTCTGCCGAGTGTTGATGGTCAGAAACGCTATACCTTCCGTGTGCGCAGTCGCTTCAATCCGCTGTGCGGTAGCGCACAGCATTGGAGTGAATGGAGCCATCCGATTCATTGGGGTAGTAATACCAGCAAAGAAAATCCGTTCCTGTTCGCCCTGGAAGCC

Related Products

CatalogName
NCP0260P-01CD132 polyclonal antibody
BS6862-01CD132/IL-2 R gamma polyclonal antibody
NCP0272-01CD152 Recombinant Protein
NCP0173-01CD123 Recombinant Protein
NCP0259-01CD131 Recombinant Protein
NCP0286-01CD162 Recombinant Protein
NCP0374-01CD102 Recombinant Protein
NCP0261-01CD133 Recombinant Protein
NCP0264-01CD138 Recombinant Protein
NCP0267-01CD142 Recombinant Protein

Alternative Products

CatalogName
96-466CD132 Recombinant Protein
MBS9144112-01Recombinant Human CD132 Protein
MBS8305153-01Recombinant Mouse CD132 Protein
RP02036Recombinant Cynomolgus CD132/IL2RG Protein
PPT-11145Human CD132/IL2RG Recombinant Protein
RP01205-01Recombinant Human IL-2RG/CD132 Protein
ARP7956-01Recombinant Human CD132 Protein (His Tag)
KMP1334Recombinant Human CD132 Protein, His Tag
CD02156-01Recombinant Human CD132 protein (C-Fc)
E901424PRecombinant Cynomolgus IL-2RG/CD132 Protein

Popular Products