Integrin α5 (CD49e) Recombinant Protein

• Background:

  Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling) . Integrin α5/β1 is involved in multiple biological processes including embryonic development, angiogenesis and tumor metastasis. By interaction with its fibronectin ligand, α5/β1 transduces signals that regulate cell adhesion, migration, matrix assembly and cytoskeletal organization.

• Swiss Prot:

  P08648

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~16kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  CCTATTAACCCGAAAGGCCTGGAACTGGATCCGGAAGGTAGTCTGCATCATCAGCAGAAACGTGAAGCACCGAGTCGCAGTAGTGCCAGTAGCGGCCCGCAGATTCTGAAATGCCCGGAAGCCGAATGCTTCCGCCTGCGCTGTGAACTGGGCCCGCTGCATCAGCAGGAAAGCCAGAGCCTGCAGCTGCACTTCCGTGTGTGGGCAAAAACCTTCCTGCAGCGTGAACATCAGCCGTTCAGCCTGCAGTGCGAAGCAGTGTATAAAGCACTGAAAATGCCGTATCGTATTCTGCCGCGCCAGCTGCCGCAGAAAGAACGCCAGGTTGCAACCGCAGTGCAGTGGACCAAAGCAGAAGGCAGCTAT