Products for Research Use Only

Integrin α3 (CD49c) Recombinant Protein

CAT: 0384-NCP0243-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0243-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Integrins are heterodimers composed of non-covalently associated transmembrane α and β subunits. The 16 α and 8 β subunits heterodimerize to produce more than 20 different receptors. Most integrin receptors bind ligands that are components of the extracellular matrix, including Fibronectin, Collagen and Vitronectin. Certain integrins can also bind to soluble ligands such as Fibrinogen, or to counterreceptors on adjacent cells such as the intracellular adhesion molecules (ICAMs), leading to aggregation of cells. Ligands serve to cross-link or cluster integrins by binding to adjacent integrin receptors; both receptor clustering and ligand occupancy are necessary for the activation of integrin-mediated responses. In addition to mediating cell adhesion and cytoskeletal organization, integrins function as signaling receptors. Signals transduced by integrins play a role in many biological processes, including cell growth, differentiation, migration and apoptosis. The Integrin α3 chain, also known as very late (activation) antigen 3 (VLA-3), very common antigen 2 (VCA-2), extracellular matrix receptor 1 (ECMR1) and galactoprotein b3 (GAPB3), undergoes posttranslational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that join with β1 to form an integrin that interacts with many extracellular-matrix proteins.
CAS Number
9000-83-3
Swiss Prot
P26006
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~36kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
TTCGGTTATAGTGTTGCCCTGCATCGCCAGACCGAACGTCAGCAGCGCTATCTGCTGCTGGCCGGTGCCCCGCGTGAACTGGCAGTTCCGGATGGTTATACCAATCGTACCGGTGCAGTGTATCTGTGCCCGCTGACCGCACATAAAGATGATTGCGAACGTATGAATATTACCGTGAAAAATGATCCGGGTCATCATATTATTGAAGATATGTGGCTGGGTGTGACCGTTGCCAGCCAGGGTCCGGCAGGCCGTGTTCTGGTGTGTGCCCATCGTTATACCCAGGTTCTGTGGAGTGGTAGTGAAGATCAGCGCCGTATGGTTGGCAAATGTTATGTGCGTGGTAATGATCTGGAACTGGATAGTAGTGATGATTGGCAGACCTATCATAATGAAATGTGCAATAGTAACACCGATTATCTGGAAACCGGCATGTGCCAGCTGGGTACCAGTGGCGGCTTCACCCAGAATACCGTGTACTTCGGTGCACCGGGTGCCTATAATTGGAAAGGTAATAGTTATATGATCCAGCGCAAAGAATGGGATCTGAGCGAATATAGTTATAAAGATCCGGAAGATCAGGGTAATCTGTATATTGGTTATACCATGCAGGTTGGTAGCTTCATTCTGCATCCGAAAAATATTACCATTGTTACCGGCGCCCCGCGCCATCGCCACATGGGTGCAGTGTTCCTGCTGAGTCAGGAAGCCGGTGGTGATCTGCGTCGCCGCCAGGTTCTGGAAGGTAGTCAGGTGGGTGCCTACTTCGGTAGCGCAATTGCACTGGCCGATCTGAATAATGATGGTTGGCAGGATCTGCTGGTGGGCGCACCGTATTACTTCGAACGCAAAGAAGAAGTGGGCGGCGCCATCTATGTGTTCATGAATCAGGCAGGCACCAGCTTCCCGGCACATCCGAGCCTGCTGCTGCATGGCCCGAGCGGTAGTGCCTTCGGCCTGAGTGTGGCCAGCATT

Popular Products