CD81 Recombinant Protein

• Background:

  CD81 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction (3) . CD81, like other tetraspanins, is enriched in exosomes. Many research studies demonstrate a role for CD81 in lymphocyte signaling. CD81 is also a well-characterized receptor for Hepatitis C Virus and facilitates the entry of the virus into target cells.

• Swiss Prot:

  P60033

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~10kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  TTCGTTAACAAGGATCAGATTGCAAAAGATGTGAAACAGTTCTATGATCAGGCCCTGCAGCAGGCAGTGGTGGATGATGATGCAAATAATGCCAAAGCAGTTGTGAAAACCTTCCATGAAACCTTAGATTGTTGCGGCAGCAGTACCCTGACCGCACTGACCACCAGTGTGCTGAAAAATAATCTGTGCCCGAGCGGTAGCAATATTATTAGTAATCTGTTCAAGGAGGACTGCCATCAGAAAATTGATGATCTGTTCAGTGGCAAA