CD320 Recombinant Protein
- Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
- Dry Ice Shipment: No


CD320 Recombinant Protein
Background :
The 8D6 protein, also known as 8D6A, CD320 or FDC-SM-8D6, is a single pass, type I membrane protein with two low-density lipoprotein receptor ligand binding repeats (LDL-A modules) . It is expressed by follicular dendritic cells in the germinal center and acts as a stimulatory signaling molecule. Follicular dendritic cells and T cells interact with germinal center B cells, providing signals for survival, proliferation and differentiation into memory B cells and plasma cells. A disruption of this interaction results in apoptosis of B cells. 8D6 is a growth factor required for plasma cell generation from germinal center B cells. Protein 8D6, together with HCAM (or CD44), plays a significant role in the proliferation of lymphoma cells of germinal center origin. 8D6 is responsible for enhancing proliferation while HCAM inhibits apoptosis.CAS Number :
9000-83-3Swiss Prot :
Q9NPF0Modification Site :
NdeI-XhoIExpression System :
Pet-22b (+)Tag :
His-tagPurity :
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .Solubility :
PBS, 4M Urea, PH7.4Molecular Weight :
~27kDaStorage Conditions :
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.Notes :
For research use only, not for use in diagnostic procedure.Host or Source :
E.coliAA Sequence :
AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

