CD320 Recombinant Protein

CAT:
384-NCP0201-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD320 Recombinant Protein - image 1

CD320 Recombinant Protein

  • Background :

    The 8D6 protein, also known as 8D6A, CD320 or FDC-SM-8D6, is a single pass, type I membrane protein with two low-density lipoprotein receptor ligand binding repeats (LDL-A modules) . It is expressed by follicular dendritic cells in the germinal center and acts as a stimulatory signaling molecule. Follicular dendritic cells and T cells interact with germinal center B cells, providing signals for survival, proliferation and differentiation into memory B cells and plasma cells. A disruption of this interaction results in apoptosis of B cells. 8D6 is a growth factor required for plasma cell generation from germinal center B cells. Protein 8D6, together with HCAM (or CD44), plays a significant role in the proliferation of lymphoma cells of germinal center origin. 8D6 is responsible for enhancing proliferation while HCAM inhibits apoptosis.
  • CAS Number :

    9000-83-3
  • Swiss Prot :

    Q9NPF0
  • Modification Site :

    NdeI-XhoI
  • Expression System :

    Pet-22b (+)
  • Tag :

    His-tag
  • Purity :

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility :

    PBS, 4M Urea, PH7.4
  • Molecular Weight :

    ~27kDa
  • Storage Conditions :

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes :

    For research use only, not for use in diagnostic procedure.
  • Host or Source :

    E.coli
  • AA Sequence :

    AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

Featured Selection

Popular Products

Discover our most sought-after biotechnology products, trusted by researchers worldwide