CD86 Recombinant Protein

CAT:
384-NCP0233-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD86 Recombinant Protein - image 1

CD86 Recombinant Protein

  • Background :

    CD80 (B7-1, BB1) and CD86 (B7-2, B70) are members of the B7 family of cell surface ligands that regulate T cell activation and immune responses. CD80 is expressed on activated antigen presenting cells, including dendritic cells, B cells, monocytes, and macrophages. CD86 is expressed on resting monocytes, dendritic cells, activated B lymphocytes, and can be further upregulated in the presence of inflammation. CD80 and CD86 are ligands for CD28, which functions as a T cell costimulatory receptor. Interaction of CD28 with CD80 or CD86 provides the second signal required for naïve T cell activation, T cell proliferation, and acquisition of effector functions. Alternatively, CD80 and CD86 also act as ligands to CTLA-4, which results in the downregulation of T cell activity.
  • Swiss Prot :

    P42081
  • Modification Site :

    NdeI-XhoI
  • Expression System :

    Pet-22b (+)
  • Tag :

    His-tag
  • Purity :

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility :

    PBS, 4M Urea, PH7.4
  • Molecular Weight :

    ~30kDa
  • Storage Conditions :

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes :

    For research use only, not for use in diagnostic procedure.
  • Host or Source :

    E.coli
  • CAS Number :

    9000-83-3
  • AA Sequence :

    GCTCCTCTGAAAATTCAGGCATACTTCAATGAAACCGCAGATCTGCCGTGTCAGTTCGCCAATAGTCAGAATCAGAGCCTGAGCGAACTGGTGGTGTTCTGGCAGGATCAGGAAAATCTGGTGCTGAATGAAGTGTATCTGGGTAAAGAAAAATTCGATAGTGTTCATAGTAAGTACATGGGCCGCACCAGCTTCGATAGTGATAGCTGGACCCTGCGTCTGCATAATCTGCAGATTAAAGATAAAGGTCTGTATCAGTGCATTATTCATCATAAAAAGCCGACCGGTATGATTCGCATTCATCAGATGAATAGTGAACTGAGTGTTCTGGCAAACTTCAGTCAGCCGGAAATTGTTCCGATTAGTAATATTACCGAAAACGTGTATATCAACCTGACCTGTAGCAGCATTCATGGTTATCCGGAACCGAAAAAAATGAGCGTTCTGCTGCGCACCAAAAATAGTACCATTGAATATGATGGCGTGATGCAGAAAAGTCAGGATAATGTTACCGAACTGTATGATGTGAGCATTAGCCTGAGCGTTAGCTTCCCGGATGTGACCAGTAATATGACCATCTTCTGCATTCTGGAAACCGATAAAACCAGACTGCTGAGTAGCCCGTTCAGTATTGAACTGGAAGATCCGCAGCCGCCGCCGGATCATATTCCG

Featured Selection

Popular Products

Discover our most sought-after biotechnology products, trusted by researchers worldwide