Products for Research Use Only
RegisterLogin

CD362 Recombinant Protein

CAT: 0384-NCP0310-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0310-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Syndecans are type I integral membrane proteoglycans that contain both chondroitin sulfate and heparan sulfate groups. Syndecans are involved in cell-extracellular matrix adhesion and growth factor binding. Syndecan-1 (SYND1, also called CD138) is anextracellular matrix receptor which binds to collagens, Fibronectin and Thrombospondin. Syndecan-1 and Syndecan-3 (also designated N-Syndecan) interact with MK (midkine), a growth/differentiation factor invloved in embryogenesis of the central nervous system. Syndecan-2 (also designated fibroglycan or HSPG) is highly expressed at areas of high morphogenetic activity, such as epithelial-mesenchymal interfaces and the prechondrogenic and preosteogenic mesenchymal condensations. Syndecan-4 (also designated amphiglycan or ryudocan) functions cooperativley with integrins in the processes of cell spreading, focal adhesion assembly and Actin stress fiber assembly
CAS Number
9000-83-3
Swiss Prot
P34741
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~27kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GAAAGCCGCGCCGAACTGACCAGCGATAAAGATATGTATCTGGATAATAGCAGCATTGAAGAAGCAAGCGGTGTGTATCCGATTGATGATGATGATTATGCAAGTGCCAGCGGTAGCGGTGCAGATGAAGATGTGGAAAGCCCGGAACTGACCACCAGTCGTCCGCTGCCGAAAATTCTGCTGACCAGCGCCGCCCCGAAAGTTGAAACCACCACCCTGAATATTCAGAATAAAATTCCGGCCCAGACCAAAAGTCCGGAAGAAACCGATAAAGAAAAAGTGCATCTGAGCGATAGTGAACGCAAAATGGATCCGGCAGAAGAAGATACCAATGTGTATACCGAAAAACATAGCGATAGTCTGTTCAAACGCACCGAA

Related Products

CatalogName
NCP0310P-01CD362 polyclonal antibody
NCP0362-01CD367 Recombinant Protein
NCP0401-01CD368 Recombinant Protein
NCP0317-01CD322 Recombinant Protein
NCP0413-01CD366 Recombinant Protein
NCP0329-01CD365 Recombinant Protein
NCP0302-01CD352 Recombinant Protein
NCP0315-01CD369 Recombinant Protein
NCP0311-01CD364 Recombinant Protein
NCP0308-01CD360 Recombinant Protein

Alternative Products

CatalogName
E43CP0310CD362 Recombinant Protein
MBS1561297-01Recombinant Human CD362 protein
PPT-11539Human CD362/SDC2 Recombinant Protein
NBP2-58489PEPSyndecan-2/CD362 Recombinant Protein Antigen
HW590011-01Human CD362/SDC2 Recombinant Protein (C-Fc)
KMH493Recombinant Human CD362/SDC2 Protein, His Tag
EHE04801Recombinant Human CD362/SDC2 Protein, C-His
AP91464Recombinant Human CD362/SDC2 Protein, N-His
ARO-P21005-01Human CD362/SDC2 Recombinant Protein, N-His
HW590032-01Human CD362/SDC2 Recombinant Protein (N-His)

Popular Products