CD360 Recombinant Protein

• Background:

  The IL-21 receptor (also designated IL-21R, NILR or novel interleukin receptor) is a type I cytokine receptor that forms a complex with the cytokine receptor γ chain, γc and mediates IL-21 signaling. IL-21R is present on the surface of natural killer, B and T cell populations with high levels in spleen and thymus. IL-21 and IL-21R influence lymphoid proliferation and early lymphoid development in the transition between innate and adaptive immunity. Tumor necrosis factor (TNF) upregulates IL-21R, and combinations of TNF and IL-21 can have synergistic effects on myeloma cell proliferation through pathways involving phosphorylation of JAK1, Stat3 and Erk1/2. The human IL-21R gene maps to chromosome 16p12.1 and encodes a 538 amino acid protein that is closely related to human IL2RB and shares 62% sequence identity to mouse Il21r.

• Swiss Prot:

  Q9HBE5

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~31kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  TGTCCGGATCTGGTGTGTTATACCGATTATCTGCAGACCGTTATCTGTATTCTGGAAATGTGGAATCTGCATCCGAGTACCCTGACCCTGACCTGGCAGGATCAGTATGAAGAACTGAAAGATGAAGCCACCAGCTGTAGTCTGCATCGCAGCGCACATAATGCCACCCATGCCACCTATACCTGTCACATGGATGTGTTCCACTTCATGGCCGATGATATCTTCAGCGTGAATATTACCGATCAGAGCGGCAATTATAGTCAGGAATGCGGTAGCTTCCTGCTGGCAGAAAGTATTAAACCGGCACCGCCGTTCAATGTGACCGTGACCTTCAGCGGTCAGTATAATATTAGCTGGCGCAGTGATTATGAAGATCCGGCCTTCTATATGCTGAAAGGCAAACTGCAGTATGAACTGCAGTATCGTAATCGCGGCGATCCGTGGGCAGTTAGCCCGCGTCGTAAACTGATTAGCGTTGATAGCCGTAGTGTGAGTCTGCTGCCGCTGGAATTCCGTAAAGATAGCAGCTATGAACTGCAAGTTCGCGCCGGCCCGATGCCGGGTAGCTCATATCAGGGCACCTGGAGCGAATGGAGTGATCCGGTTATCTTCCAGACCCAGAGTGAAGAACTGAAGGAA