Products for Research Use Only

CD355 Recombinant Protein

CAT: 0384-NCP0305-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0305-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
CD355, mediates heterophilic cell-cell adhesion which regulates the activation, differentiation and tissue retention of various T-cell subsets. Interaction with CADM1 promotes natural killer (NK) cell cytotoxicity and IFNG/interferon-gamma secretion by CD8+ T-cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM1 in vivo. Regulates CD8+ T-cell proliferation in response to T-cell receptor (TCR) activation. Appears to be dispensable for CD8+ T-cell-mediated cytotoxicity. Interaction with SCRIB promotes the late phase of cellular polarization of a subset of CD4+ T-cells, which in turn regulates TCR-mediated proliferation and IFNG, IL17 and IL22 production. By interacting with CADM1 on CD8+ dendritic cells, regulates the retention of activated CD8+ T-cells within the draining lymph node (By similarity) . Required for the intestinal retention of intraepithelial CD4+ CD8+ T-cells and, to a lesser extent, intraepithelial and lamina propria CD8+ T-cells and CD4+ T-cells (By similarity) . Interaction with CADM1 promotes the adhesion to gut-associated CD103+ dendritic cells, which may facilitate the expression of gut-homing and adhesion molecules on T-cells and the conversion of CD4+ T-cells into CD4+ CD8+ T-cells (By similarity) .
CAS Number
9000-83-3
Swiss Prot
O95727
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~40kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
AGCCTGACCAATCATACCGAAACCATTACCGTTGAAGAAGGCCAGACCCTGACCCTGAAATGTGTGACCAGTCTGCGTAAAAATAGTAGCCTGCAGTGGCTGACCCCGAGCGGCTTCACCATCTTCCTGAATGAATATCCGGCCCTGAAAAATAGCAAATATCAGCTGCTGCATCATAGCGCAAATCAGCTGAGCATTACCGTGCCGAATGTTACCCTGCAGGATGAAGGCGTGTATAAATGCCTGCATTATAGTGATAGTGTGAGCACCAAAGAAGTGAAAGTTATTGTGCTGGCAACCCCGTTCAAACCGATTCTGGAAGCAAGTGTTATTCGTAAACAGAATGGCGAAGAACATGTGGTTCTGATGTGTAGTACCATGCGTAGCAAACCGCCGCCGCAGATTACCTGGCTGCTGGGTAATAGCATGGAAGTGAGCGGCGGTACCCTGCATGAATTCGAAACCGATGGTAAAAAATGCAATACCACCAGCACCCTGATTATTCATACCTATGGTAAAAATAGCACCGTTGATTGTATTATTCGTCATCGTGGTCTGCAGGGTCGCAAACTGGTTGCACCGTTCCGCTTCGAAGATCTGGTGACCGATGAAGAAACCGCCAGCGATGCACTGGAACGCAATAGCCTGAGTAGCCAGGATCCGCAGCAGCCGACCAGCACCGTTAGCGTTACCGAAGATAGCAGCACCAGTGAAATTGATAAAGAAGAAAAAGAGCAGACCACCCAGGATCCGGATCTGACCACCGAAGCCAATCCGCAGTATCTGGGCCTGGCACGTAAAAAAAGCGGC