Products for Research Use Only
RegisterLogin

CD354 Recombinant Protein

CAT: 0384-NCP0304-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0304-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
TREM-1 (triggering receptor expressed on myeloid cells-1) is expressed in monocytes and neutrophils but not in lymphocytes, dendritic cells, or other cell types. TREM-1 is a glycoprotein that is reduced by deglycosylation, in agreement with the predicted molecular mass. TREM-1 is an activating receptor of the Ig superfamily that is expressed on human myeloid cells, selectively expressed on blood neutrophils and a subset of monocytes, and is upregulated by bacterial LPS. Immunoblot analysis shows that TREM-1 is associated with DAP12, a molecule frequently associated with activating receptors. TREM-1 and the myeloid DAP12-associating lectin (MDL-1) are recently identified receptors which associate non-covalently with DAP12 to form receptor complexes that are involved in monocytic activation and inflammatory response.
CAS Number
9000-83-3
Swiss Prot
Q9NP99
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~24kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GCAACCAAACTGACCGAAGAAAAATATGAACTGAAAGAAGGTCAGACCCTGGATGTGAAATGCGATTATACCCTGGAAAAATTCGCAAGTAGCCAGAAAGCATGGCAGATTATTCGTGATGGCGAAATGCCGAAAACCTTAGCCTGTACCGAACGTCCGAGCAAAAATAGTCATCCGGTTCAGGTTGGCCGCATTATTCTGGAAGATTATCATGATCATGGTCTGCTGCGCGTGCGTATGGTTAATCTGCAGGTGGAAGATAGTGGTCTGTATCAGTGCGTGATCTATCAGCCGCCGAAAGAACCGCACATGCTGTTCGATCGTATTCGTCTGGTGGTTACCAAAGGCTTCAGTGGCACCCCGGGTAGTAATGAAAATAGCACCCAGAATGTGTATAAAATTCCGCCGACCACCACCAAAGCCCTGTGTCCGCTGTATACCAGCCCGCGCACCGTTACCCAGGCCCCTCCTAAAAGCACCGCCGATGTGAGTACCCCGGATAGCGAAATTAATCTGACCAATGTTACCGATATTATCCGCGTTCCGGTGTTCAAT

Related Products

CatalogName
BS62551-01CD354 polyclonal antibody
NCP0306-01CD357 Recombinant Protein
NCP0302-01CD352 Recombinant Protein
NCP0314-01CD314 Recombinant Protein
NCP0305-01CD355 Recombinant Protein
NCP0361-01CD334 Recombinant Protein
NCP0311-01CD364 Recombinant Protein
NCP0301-01CD351 Recombinant Protein
NCP0303-01CD353 Recombinant Protein
NCP0366-01CD304 Recombinant Protein

Alternative Products

CatalogName
E43CP0304CD354 Recombinant Protein
MBS8305195-01Recombinant Mouse CD354 Protein
TD-ATMP00489HURecombinant Human CD354 protein
PX-P6227-100Human CD354-TREM1 recombinant protein
PPT-16404Mouse CD354/TREM1 Recombinant Protein
PPT-11530Human CD354/TREM1 Recombinant Protein
GB300631-H-500μgRecombinant Human CD354 Protein (His-tag)
RP00168-01Recombinant Human TREM-1/CD354 Protein
MV219011-01Mouse CD354/TREM1 Recombinant Protein (C-His)
MBS1579185-01Recombinant Mouse CD354/TREM1 Protein, N-His

Popular Products