Products for Research Use Only

CD336 Recombinant Protein

CAT: 0384-NCP0296-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0296-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Natural killer (NK) cells direct cytotoxicity against tumor or virally infected cells. NK cell-mediated cytotoxicity is stimulated by several activating receptors associated with the signaling adapter DNAX activation 12/killer cellactivating receptor-associated protein (DAP12) . NKp44 is a natural cytotoxicity receptor that is expressed on IL-2-activated human NK cells and may contribute to the increased efficiency of NK cells to mediate tumor cell lysis. NKp44 is composed of one Ig-like extracellular domain, a transmembrane segment and a cytoplasmic domain. Prolactin upregulates and cortisol downregulates the surface expression of NKp44 at the transcriptional level. A cellular ligand for NKp44 (NKp44L) is expressed during HIV-1 infection and is correlated with the progression of CD4+ T cell depletion and an increase of viral load. This implicates NKp44 as a therapeutic agent that may aid in the progress towards a vaccine for HIV-1 infection.
CAS Number
9000-83-3
Swiss Prot
O95944
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~19kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CAGAGTAAAGCCCAGGTTCTGCAGAGCGTGGCCGGTCAGACCCTGACCGTGCGTTGTCAGTATCCGCCGACCGGCAGCCTGTATGAAAAAAAAGGTTGGTGTAAAGAAGCAAGTGCACTGGTGTGTATTCGTCTGGTGACCAGCAGTAAACCGCGTACCATGGCATGGACCAGTCGCTTCACCATCTGGGATGATCCGGATGCCGGCTTCTTCACCGTTACCATGACCGATCTGCGCGAAGAAGATAGTGGCCATTATTGGTGCCGTATCTATCGTCCGAGTGATAATAGCGTGAGCAAAAGCGTTCGCTTCTATCTGGTTGTTAGTCCGGCAAGTGCAAGCACCCAGACCAGCTGGACCCCGCGTGATCTGGTTAGTAGCCAGACCCAGACCCAGAGTTGCGTGCCGCCGACCGCCGGTGCACGTCAAGCTCCTGAAAGTCCGAGCACCATTCCGGTTCCGAGTCAGCCGCAGAATAGTACCCTGCGTCCGGGCCCGGCAGCACCTATTGCA