CD137 Recombinant Protein

• Background:

  TNFRSF9 is a member of the tumor necrosis factor receptor superfamily. It is also called 4-1BB or CD137. 4-1BB/CD137/TNFRSF9 is expressed in activated CD4+ and CD8+ T cells, natural killer cells and dendritic cells. The ligand 4-1BBL/CD137L/TNFSF9 on antigen presenting cells binds to 4-1BB/CD137/TNFRSF9 and costimulates the activation of T cells. The binding of agonistic antibodies to 4-1BB/CD137/TNFRSF9 also leads to costimulation for T cell activation. Studies have shown the effectiveness of targeting 4-1BB/CD137/TNFRSF9 by its agonistic antibodies in cancer immunotherapy.

• Swiss Prot:

  Q07011

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~24kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  CTGCAGGATCCGTGTAGCAATTGCCCGGCAGGTACCTTCTGTGATAATAATCGCAATCAGATCTGTAGCCCGTGTCCGCCGAATAGCTTCAGTAGCGCCGGCGGTCAGCGCACCTGTGATATCTGTCGCCAGTGTAAAGGCGTGTTCCGTACCCGTAAAGAATGCAGCAGCACCAGTAATGCCGAATGTGATTGTACCCCGGGCTTCCATTGCCTGGGCGCAGGTTGTAGCATGTGTGAACAGGATTGCAAACAGGGTCAGGAACTGACCAAAAAAGGCTGTAAAGATTGCTGCTTCGGTACCTTCAATGATCAGAAACGCGGTATCTGTCGTCCGTGGACCAATTGCAGCCTGGATGGCAAAAGTGTTCTGGTTAATGGTACCAAAGAACGTGATGTTGTGTGCGGTCCGAGTCCGGCAGATCTGAGCCCGGGCGCAAGCAGTGTGACCCCGCCTGCTCCGGCACGTGAACCGGGTCATAGTCCGCAG