CD119 Recombinant Protein

• Background:

  IFN-γ plays key roles in both the innate and adaptive immune response. IFN-γ activates the cytotoxic activity of innate immune cells, such as macrophages and NK cells. IFN-γ production by NK cells and antigen presenting cells (APCs) promotes cell-mediated adaptive immunity by inducing IFN-γ production by T lymphocytes, increasing class I and class II MHC expression, and enhancing peptide antigen presentation. The anti-viral activity of IFN-γ is due to its induction of PKR and other regulatory proteins. Binding of IFN-γ to the IFNGR1/IFNGR2 complex promotes dimerization of the receptor complexes to form the (IFNGR1/IFNGR2) 2 -IFN-γ dimer. Binding induces a conformational change in receptor intracellular domains and signaling involves Jak1, Jak2, and Stat1. The critical role of IFN-γ in amplification of immune surveillance and function is supported by increased susceptibility to pathogen infection by IFN-γ or IFNGR knockout mice and in humans with inactivating mutations in IFNGR1 or IFNGR2. IFN-γ also appears to have a role in atherosclerosis.

• Swiss Prot:

  P15260

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~30kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  GAAATGGGTACCGCCGATCTGGGTCCGAGCAGTGTGCCGACCCCGACCAATGTGACCATTGAAAGCTATAATATGAACCCGATTGTGTATTGGGAATATCAGATTATGCCGCAGGTTCCGGTGTTCACCGTGGAAGTGAAAAATTATGGTGTGAAAAATAGCGAATGGATTGATGCATGCATTAATATTAGCCATCATTATTGTAACATCAGCGATCATGTTGGCGATCCGAGCAATAGCCTGTGGGTGCGTGTGAAAGCCCGCGTTGGCCAGAAAGAAAGCGCATACGCTAAAAGCGAAGAATTCGCAGTGTGTCGCGATGGCAAAATTGGCCCGCCGAAACTGGATATTCGCAAAGAAGAAAAACAGATTATGATCGATATCTTCCATCCGAGTGTGTTCGTGAATGGTGATGAACAGGAAGTTGATTATGATCCGGAAACCACCTGTTATATTCGCGTGTATAATGTGTATGTTCGCATGAATGGTAGCGAAATTCAGTATAAAATCCTGACCCAGAAAGAAGATGATTGTGATGAAATTCAGTGTCAGCTGGCAATTCCGGTGAGTAGTCTGAATAGTCAGTATTGTGTGAGCGCAGAAGGCGTTCTGCATGTGTGGGGTGTGACCACCGAAAAAAGTAAAGAAGTGTGTATTACCATCTTCAATAGTAGCATTAAGGGT