Products for Research Use Only

CD262 Recombinant Protein

CAT: 0384-NCP0195-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0195-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL) . They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain (DD) . The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases. DR5 is a receptor for TNF-related apoptosis inducing ligand (TRAIL), which has been shown to induce apoptosis in a variety of cell types and has been targeted for cancer therapy. Structurally, DR5 contains an amino-terminal leader cleavage site, followed by an extracellular region containing two cysteine-rich repeats, a central transmembrane domain, and a carboxy-terminal DD. DR5 is expressed in a wide variety of tissues and is a transcriptional target of p53. It induces apoptosis through a FADD-dependent pathway. Deletion of DR5 leads to resistance in TRAIL-mediated apoptosis as well as an abrogated response to DNA-damaging stimuli. At least two isoforms of DR5 are produced by alternative splicing.
CAS Number
9000-83-3
Swiss Prot
O14763
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~24kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
ATCACCCAGCAGGATCTGGCACCGCAGCAGCGCGCAGCCCCTCAACAGAAACGTAGTAGCCCGAGCGAAGGTCTGTGCCCGCCGGGTCATCATATTAGCGAAGATGGCCGTGATTGCATTAGCTGCAAATATGGTCAGGATTATAGTACCCATTGGAATGATCTGCTGTTCTGTCTGCGTTGTACCCGCTGTGATAGTGGTGAAGTTGAACTGAGTCCGTGTACCACCACCCGTAATACCGTGTGCCAGTGCGAAGAAGGCACCTTCCGCGAAGAAGATAGCCCGGAAATGTGCCGCAAATGCCGTACCGGCTGCCCGCGCGGTATGGTTAAAGTTGGTGATTGTACCCCGTGGAGTGATATTGAATGCGTTCATAAAGAAAGTGGTACCAAACATAGCGGCGAAGTGCCGGCAGTGGAAGAAACCGTTACCAGCAGCCCGGGCACCCCGGCTAGCCCTTGTAGC