Products for Research Use Only

CD253 Recombinant Protein

CAT: 0384-NCP0194-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0194-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Tumor necrosis factor (TNF) -related apoptosis-inducing ligand (TRAIL), also referred to as Apo2 ligand, first identified based on its sequence homology to TNF and Fas/Apo ligand is a member of the TNF family of cytokines and either exists as a type II membrane or soluble protein. TRAIL induces apoptosis in a variety of transformed cell lines and plays a role in anti-tumor and anti-viral immune surveillance. TRAIL signals via binding with death receptors DR4 (TRAIL-R1) and DR5 (TRAIL-R2) which can trigger apoptosis as well as NF-κB activation. Death domains on these receptors leads to the recruitment of a death-induced signaling complex (DISC) leading to caspase-8 and subsequent caspase-3 activation. In addition, TRAIL binds with decoy receptors DcR1 (TRAIL-R3) and DcR2 (TRAIL-R4, TRUNDD) which lack the functional cytoplasmic death domain antagonizing TRAIL-induced apoptosis. Osteoprotegerin (OPG) has also been identified as receptor capable of inhibiting TRAIL-induced apoptosis. The selectivity of soluble TRAIL at triggering apoptosis in transformed cells as compared to normal cells has led to its investigation as a potential cancer therapeutic.
CAS Number
9000-83-3
Swiss Prot
P50591
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~27kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
ACCAATGAACTGAAACAGATGCAGGATAAATATAGTAAAAGCGGTATTGCCTGCTTCCTGAAAGAAGATGATAGTTATTGGGATCCGAATGATGAAGAAAGCATGAATAGTCCGTGCTGGCAGGTGAAATGGCAGCTGCGTCAGCTGGTGCGCAAAATGATTCTGCGTACCAGCGAAGAAACCATTAGCACCGTGCAGGAAAAACAGCAGAATATTAGTCCGCTGGTTCGCGAACGCGGCCCGCAGAGAGTGGCAGCTCATATTACCGGCACCCGTGGCCGCAGTAATACCCTGAGCAGCCCGAATAGTAAAAATGAAAAAGCCCTGGGCCGCAAAATTAATAGCTGGGAAAGCAGCCGCAGTGGTCATAGCTTCCTGAGTAATCTGCATCTGCGTAATGGCGAACTGGTTATTCATGAAAAAGGCTTCTATTATATCTACAGCCAGACCTACTTCCGCTTCCAGGAAGAAATTAAAGAAAATACCAAGAACGACAAGCAGATGGTGCAGTATATCTATAAATATACCAGCTATCCGGATCCGATTCTGCTGATGAAAAGCGCCCGTAATAGTTGCTGGAGCAAAGATGCAGAATATGGTCTGTATAGTATCTATCAGGGTGGCATCTTCGAACTGAAAGAAAATGATCGTATCTTCGTGAGCGTGACCAATGAACATCTGATTGATATGGATCATGAAGCCAGCTTCTTCGGTGCATTCCTGGTTGGT

Popular Products