SiRNA Negative Control | Gentaur

Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Dry Ice Shipment: No

Alternative Products

Cat	Name
abx941273-150g	siRNA Negative Control
abx941273-25nmol	siRNA Negative Control
abx941273-300g	siRNA Negative Control
MBS8241404-02	siRNA Negative Control
MBS8241404-01	siRNA Negative Control
MBS8241404-04	siRNA Negative Control
abx941273-5nmol	siRNA Negative Control
MBS8241404-03	siRNA Negative Control
MBS2568128-1mL	Negative Control
E-HD-N	Negative Control

SiRNA Negative Control

CAT:

804-HY-150150-03

Size:

1 mg

Price:

Ask

For price, please contact [email protected].

SiRNA Negative Control

UNSPSC Description: SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control.
Target Antigen: Small Interfering RNA (siRNA)
Type: Oligonucleotides
Related Pathways: Epigenetics
Applications: COVID-19-immunoregulation
Field of Research: Inflammation/Immunology
Assay Protocol: https://www.medchemexpress.com/sirna-control.html
Solubility: H2O : 100 mg/mL (ultrasonic)
Smiles: [RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA) (1:1)]
Molecular Weight: 13323 ( AS: 6586.9; SS: 6736.1 )
Shipping Conditions: Blue Ice
Clinical Information: No Development Reported

Complementary Product Range

Our range of products, including SiRNA Negative Control, falls within the same field of application and can be used across various research projects. These products are carefully selected for their high performance and reliability, supporting the diverse needs of modern laboratories. Whether for ongoing studies or future experiments, they are designed to help researchers achieve their scientific goals. Here are some related products that may be of interest for similar or future applications:

Related Products

Cat	Name
HY-150150-01	SiRNA Negative Control
HY-150150-02	SiRNA Negative Control
HY-150150-03	SiRNA Negative Control
HY-P4907-01	RGD Negative Control
HY-148410C	Zorevunensen negative control
HY-P4907-02	RGD Negative Control
HY-P4907-03	RGD Negative Control
HY-112402-01	SP 600125, negative control
HY-112402-02	SP 600125, negative control
HY-13259D-01	MG-132 (negative control)

Each item in our collection, is tested for precision and quality, ensuring dependable solutions for your research. As we continue to incorporate the latest advancements, Gentaur ensures that our product range remains relevant and versatile, providing you with the tools needed for both current and future projects.

Find us on