SiRNA Negative Control
- Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
- Dry Ice Shipment: No


SiRNA Negative Control
Description :
SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.UNSPSC :
12352208Target :
Small Interfering RNA (siRNA)Type :
OligonucleotidesRelated Pathways :
EpigeneticsApplications :
COVID-19-immunoregulationField of Research :
Inflammation/ImmunologyAssay Protocol :
https://www.medchemexpress.com/sirna-control.htmlPurity :
99.24Solubility :
H2O : 100 mg/mL (ultrasonic)Smiles :
[RNA,(UUCUCCGAACGUGUCACGUUU),complexwithRNA,(ACGUGACACGUUCGGAGAAUU)(1:1)]Molecular Weight :
13323.03Shipping Conditions :
Blue IceStorage Conditions :
-20°C (Powder, sealed storage, away from moisture)Scientific Category :
OligonucleotidesClinical Information :
No Development Reported

