RPL13A cDNA

• Description :

  RPL13A encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. It also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

• Product Name Alternative :

  L13A, TSTA1

• Chromosomal Location :

  19q13.3

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGGCCATCTCCTGGGCCGCCTGGCGGCCATCGTGGCTAAACAGGTACTGCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGCAATTTCTACAGAAACAAGTTGAAGTACCTGGCTTTCCTCCGCAAGCGGATGAACACCAACCCTTCCCGAGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTATGCTGCCCCACAAAACCAAGCGAGGCCAGGCCGCTCTGGACCGTCTCAAGGTGTTTGACGGCATCCCACCGCCCTACGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTCGTGCGTCTGAAGCCTACAAGAAAGTTTGCCTATCTGGGGCGCCTGGCTCACGAGGTTGGCTGGAAGTACCAGGCAGTGACAGCCACCCTGGAGGAGAAGAGGAAAGAGAAAGCCAAGATCCACTACCGGAAGAAGAAACAGCTCATGAGGCTACGGAAACAGGCCGAGAAGAACGTGGAGAAGAAAATTGACAAATACACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGA

• Additionnal Information :

  RPL13A, L13A, TSTA1, RPL13A, ATGD0336-10 µg, ATGD0336-20 µg, ATGD0336-50 µg, ATGD0336-100 µg, ATGD0336-250 µg, ATGD0336-500 µg, ATGD0336-1 mg, ATGD0336-10, ATGD0336-20, ATGD0336-50, ATGD0336-100, ATGD0336-250, ATGD0336-500, ATGD0336-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Epigenetics and Nuclear Signaling

• NCBI Accession Number :

  NP_036555.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_012423.3

• DNA Size :

  612bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.