RPL13 cDNA

• Description:

  RPL13 encodes a ribosomal protein that is a component of the 60S subunit. RPL13 belongs to the L13E family of ribosomal proteins. RPL13 is located in the cytoplasm. RPL13 is expressed at significantly higher levels in benign breast lesions than in breast carcinomas. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of RPL13 dispersed through the genome.

• Product Name Alternative:

  BBC1, D16S444E, D16S44E, L13

• Chromosomal Location:

  16q24.3

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGCGCCCAGCCGGAATGGCATGGTCTTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCCACGTGGTTCAACCAGCCGGCCCGTAAGATCCGCAGACGTAAGGCCCGGCAAGCCAAGGCGCGCCGCATCGCCCCGCGCCCCGCGTCGGGTCCCATCCGGCCCATCGTGCGCTGCCCCACGGTTCGGTACCACACGAAGGTGCGCGCCGGCCGCGGCTTCAGCCTGGAGGAGCTCAGGGTGGCCGGCATTCACAAGAAGGTGGCCCGGACCATCGGCATTTCTGTGGATCCGAGGAGGCGGAACAAGTCCACGGAGTCCCTGCAGGCCAACGTGCAGCGGCTGAAGGAGTACCGCTCCAAACTCATCCTCTTCCCCAGGAAGCCCTCGGCCCCCAAGAAGGGAGACAGTTCTGCTGAAGAACTGAAACTGGCCACCCAGCTGACCGGACCGGTCATGCCCGTCCGGAACGTCTATAAGAAGGAGAAAGCTCGAGTCATCACTGAGGAAGAGAAGAATTTCAAAGCCTTCGCTAGTCTCCGTATGGCCCGTGCCAACGCCCGGCTCTTCGGCATACGGGCAAAAAGAGCCAAGGAAGCCGCAGAACAGGATGTTGAAAAGAAAAAATAA

• Additionnal Information:

  RPL13, BBC1, D16S444E, D16S44E, L13, RPL13, ATGD0324-10 µg, ATGD0324-20 µg, ATGD0324-50 µg, ATGD0324-100 µg, ATGD0324-250 µg, ATGD0324-500 µg, ATGD0324-1 mg, ATGD0324-10, ATGD0324-20, ATGD0324-50, ATGD0324-100, ATGD0324-250, ATGD0324-500, ATGD0324-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Epigenetics and Nuclear Signaling

• Omim:

  113703

• NCBI Accession Number:

  NP_150254.1

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_033251.2

• DNA Size:

  636bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.