Products for Research Use Only

LexA | LexA repressor (protein, positive control)

CAT: 0451-AS21 4541PSize: 20 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0451-AS21 4541PSize:20 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA) . LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
HS Code
38221900
UniProt
P0A7C2
Applications
Western blot (WB)
Field of Research
Bacteria
Purity
Contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90% pure by SDS-PAGE.
Format
Liquid
Molecular Weight
22.3 | 23 kDa
Precautions
LexA protein is full-length, highly purified (over 90%, SDS-PAGE) provided at a concentration of 1 mg/mL estimated by BCA method. UniProt:P0A7C2
Additionnal Information
This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies
Storage Conditions
Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Product Datasheet
Loading...