pGB BID siRNA Vector Mix
-
Catalog number9515-60
-
PricePlease ask
-
Size60 μg
-
-
DescriptionpGB expression vector to supress BID apoptotic activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.
-
Product Highlights• GeneBlocker™ BID siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
-
Storage Temp-20°C
-
Shippinggel pack
-
Shelf Life12 months
-
NotesFor research use only. Not to be used for human or animal treatment or consumption.
-
Gene target
-
Gene symbolBID
-
Short namepGB BID siRNA Vector
-
Techniquesirna, Vectors
-
Alternative namepGB BH3 interacting domain death a this GO nist small interfearing RNA integrating Desoxyribonucleic acid sequence Mix
-
Alternative to gene targetBH3 interacting domain death a this GO nist, FP497, BID and IDBG-1050 and ENSG00000015475 and 101929618,637, ubiquitin protein ligase binding, Plasma membranes, Bid and IDBG-184076 and ENSMUSG00000004446 and 12122, BID and IDBG-641320 and ENSBTAG00000013988 and 510373,782484
-
Gene info
-
Identity
-
Gene
-
Long gene nameBH3 interacting domain death agonist
-
GenBank acession
-
Locus
-
Discovery year1998-04-20
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- MicroRNA protein coding host genes
- BCL2 homology region 3 (BH3) only
- Receptor ligands
-
VEGA ID
MeSH Data
-
Name
-
ConceptScope note: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
-
Tree numbers
- E05.393.350.800
-
Qualifiersethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data