pGB CIAP-1 siRNA Vector Mix

  • Catalog number
    9516-60
  • Price
    1005.15 USD
  • Size
    60 μg
  • Description
    pGB expression vector to supress CIAP-1 apoptotic activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.
  • Product Highlights
    • GeneBlocker™ cIAP-1 siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
  • Storage Temp
    -20°C
  • Shipping
    gel pack
  • Shelf Life
    12 months
  • Notes
    For research use only. Not to be used for human or animal treatment or consumption.
  • Gene target
    pGB   CIAP-1   siRNA   Vector  
  • Gene symbol
    BIRC2, IGHVII-1-1, MIR1-1, TRUND-NNN8-1, TRUND-NNN7-1, IGKV1OR2-1, MIR1289-1, MIR101-1, MIR16-1
  • Short name
    pGB CIAP-1 siRNA Vector
  • Technique
    sirna, Vectors
  • Alternative name
    pGB CIAP-1 small interfearing RNA integrating Desoxyribonucleic acid sequence Mix
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    immunoglobulin heavy variable (II)-1-1 (pseudogene)
  • Synonyms gene name
    • immunoglobulin heavy variable (II)-1-1
    • immunoglobulin heavy variable (II)-1-1 pseudogene
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2000-04-17
  • Entrez gene record
  • RefSeq identity
  • Classification
    • Immunoglobulin heavy locus at 14q32.33
  • VEGA ID
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-undetermined (NNN) 8-1
  • Synonyms gene name
    • transfer RNA-undetermined (NNN) 8-1
  • GenBank acession
  • Locus
    1
  • Discovery year
    2014-06-20
  • Entrez gene record
  • Pubmed identfication
Gene info
  • Identity
  • Gene
  • Long gene name
    tRNA-undetermined (NNN) 7-1
  • Synonyms gene name
    • transfer RNA-undetermined (NNN) 7-1
  • GenBank acession
  • Locus
    1
  • Discovery year
    2014-06-20
  • Entrez gene record
  • Pubmed identfication
Gene info
  • Identity
  • Gene
  • Long gene name
    immunoglobulin kappa variable 1/OR2-1 (pseudogene)
  • Synonyms gene
  • Synonyms gene name
    • immunoglobulin kappa variable 1/OR-1
    • immunoglobulin kappa variable 1/OR-1 pseudogene
    • immunoglobulin kappa variable 1/OR-1 (pseudogene)
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2000-04-18
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Immunoglobulin kappa (IGK) orphons
  • VEGA ID
Gene info
Gene info
Gene info
MeSH Data
  • Name
  • Concept
    Scope note: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
  • Tree numbers
    • E05.393.350.800
  • Qualifiers
    ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data
Product images
Similar products
Filters
Contact
Chat with gentaur.com employee