pGB BAD siRNA Vector Mix
-
Catalog number9512-60
-
PricePlease ask
-
Size60 μg
-
-
DescriptionpGB expression vector to supress BAD apoptotic activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.
-
Product Highlights• GeneBlocker™ BAD siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
-
Storage Temp-20°C
-
Shippinggel pack
-
Shelf Life12 months
-
NotesFor research use only. Not to be used for human or animal treatment or consumption.
-
Gene target
-
Gene symbolBAD, LAMP5
-
Short namepGB BAD siRNA Vector
-
Techniquesirna, Vectors
-
Alternative namepGB BCL2-associated a this GO nist on cell death small interfearing RNA integrating Desoxyribonucleic acid sequence Mix
-
Alternative to gene targetBCL2-associated a this GO nist of cell death, BBC2 and BCL2L8, BAD and IDBG-53423 and ENSG00000002330 and 572, protein heterodimerization activity, Cytoplasm, Bad and IDBG-137335 and ENSMUSG00000024959 and 12015, BT.55802 and IDBG-643918 and ENSBTAG00000012511 and 615013
-
Gene info
-
Identity
-
Gene
-
Long gene nameBCL2 associated agonist of cell death
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1997-10-16
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- BCL2 homology region 3 (BH3) only
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namelysosomal associated membrane protein family member 5
-
Synonyms gene
-
Synonyms gene name
- chromosome 20 open reading frame 103
- lysosomal-associated membrane protein family, member 5
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-07-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Lysosome associated membrane proteins
-
VEGA ID
MeSH Data
-
Name
-
ConceptScope note: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
-
Tree numbers
- E05.393.350.800
-
Qualifiersethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data