CD161 Recombinant Protein

• Background :

  CD161/KLRB1 (Killer cell lectin-like receptor subfamily B member 1, also known as CLEC5B and NKR-P1A) is a type II transmembrane protein that is expressed on the majority of Natural Killer (NK) cells, NK T cells, and some T lymphocytes. CD161/KLRB1 is also expressed on Th17 cells, promotes their generation, and modulates their function. Engagement with its ligand lectin-like transcript 1 (LLT1) inhibits NK cell function, while LLT1 and CD161/KLRB1 interaction in the presence of a TCR signal enhances IFN-gamma production by T cells. There are several different CD161 isoforms in rodents and some function as activating receptors as well.

• Swiss Prot :

  Q12918

• Modification Site :

  NdeI-XhoI

• Expression System :

  Pet-22b (+)

• Tag :

  His-tag

• Purity :

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility :

  PBS, 4M Urea, PH7.4

• Molecular Weight :

  ~22kDa

• Storage Conditions :

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes :

  For research use only, not for use in diagnostic procedure.

• Host or Source :

  E.coli

• CAS Number :

  9000-83-3

• AA Sequence :

  CAGAAAAGCAGTATTGAAAAGTGTAGCGTTGATATTCAGCAGAGTCGCAATAAAACCACCGAACGTCCGGGCCTGCTGAATTGCCCGATCTATTGGCAGCAGCTGCGTGAAAAATGCCTGCTGTTCAGCCATACCGTTAATCCGTGGAATAATAGTCTGGCCGATTGCAGTACCAAAGAAAGTAGTCTGCTGCTGATTCGTGATAAAGATGAACTGATTCATACCCAGAATCTGATTCGTGACAAAGCCATTCTGTTCTGGATTGGCCTGAACTTCAGCCTGAGCGAAAAAAATTGGAAATGGATTAATGGCAGCTTCCTGAATAGCAATGATCTGGAAATTCGTGGTGATGCAAAAGAAAATAGTTGCATTAGTATCAGCCAGACCAGTGTGTATAGTGAATATTGCAGTACCGAAATTCGTTGGATCTGTCAGAAAGAACTGACCCCGGTGCGCAATAAAGTGTATCCGGATAGC