CD79A Recombinant Protein
- Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
- Dry Ice Shipment: No


CD79A Recombinant Protein
Background :
Antigen receptors found on the surface of B cells contain a heterodimeric signaling component composed of CD79A and CD79B, also known as Ig α and Ig β, respectively. Presence of this receptor complex is essential for B-cell development and function. Together these two proteins and the associated B cell receptor initiate intracellular signaling following antigen binding. An immunoreceptor tyrosine-based activation motif (ITAM) found in the CD79A intracellular region appears to be important for its function. Antigen binding precedes formation of the CD79A and CD79B heterodimer and subsequent activation of receptor associated kinases. Research has shown that CD79A is a marker for B-lineage lymphoblastic leukemia. Additionally, investigators have found that mutations in the CD79A (MB1) gene are associated with abnormally low levels of functional B cell receptors in some cases of chronic B cell lymphocytic leukemia.Swiss Prot :
P11912Modification Site :
NdeI-XhoIExpression System :
Pet-22b (+)Tag :
His-tagPurity :
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .Solubility :
PBS, 4M Urea, PH7.4Molecular Weight :
~15kDaStorage Conditions :
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.Notes :
For research use only, not for use in diagnostic procedure.Host or Source :
E.coliCAS Number :
9000-83-3AA Sequence :
CTGTGGATGCATAAAGTGCCGGCCAGCCTGATGGTTAGCCTGGGCGAAGATGCACACTTCCAGTGTCCGCATAATAGTAGTAATAATGCAAATGTGACCTGGTGGCGCGTGCTGCATGGTAATTATACCTGGCCGCCGGAATTCCTGGGTCCGGGTGAAGATCCGAATGGTACCCTGATTATTCAGAATGTTAATAAAAGCCACGGCGGTATCTATGTGTGTCGTGTTCAGGAAGGCAATGAAAGTTATCAGCAGAGCTGTGGTACCTATCTGCGTGTTCGTCAGCCGCCGCCGCGCCCGTTCTTAGATATGGGTGAAGGTACCAAAAATCGT

