Products for Research Use Only

CD5 Recombinant Protein

CAT: 0384-NCP0214-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0214-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
CD5 is a type-I transmembrane protein belonging to the scavenger receptor cysteine-rich (SRCR) family, characterized by the presence of at least one SRCR domain of 90-110 amino acids. CD5 is expressed by all mature T cells, the B-1a subset of mature B cells, and some leukemic B cells. Its expression is increased in regulatory T and B cells (Tregs/Bregs) . Anergic T and B cells also have elevated CD5 expression. Elevated levels of CD5 are also found in many autoimmune disorders. CD5 is associated with the T cell receptor (TCR) and negatively modulates T cell activation and differentiation. CD5 expression on the tumor infiltrating T lymphocytes is inversely correlated with their antitumor activity. Recently it was reported that CD5 directly binds to IL6 and can mediate downstream signaling. CD5+ B cells promote tumor growth in animal models. Reagents targeting CD5 have been actively pursued as therapeutic interventions for cancer and other conditions.
CAS Number
9000-83-3
Swiss Prot
P06127
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~38kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CGTCTGAGTTGGTATGATCCGGACTTCCAGGCACGCCTGACCCGCAGTAATAGTAAATGTCAGGGTCAGCTGGAAGTGTATCTGAAAGATGGCTGGCACATGGTGTGTAGCCAGAGCTGGGGTCGTAGCAGTAAACAGTGGGAAGATCCGAGCCAGGCCAGTAAAGTGTGTCAGCGTCTGAATTGTGGTGTGCCGCTGAGTCTGGGCCCGTTCCTGGTTACCTATACCCCGCAGAGCAGCATTATCTGTTATGGCCAGCTGGGTAGCTTCAGTAATTGTAGTCATAGTCGCAATGATATGTGCCATAGTCTGGGTCTGACCTGCCTGGAACCGCAGAAAACCACCCCGCCGACCACCCGTCCGCCGCCTACCACCACACCGGAACCGACCGCACCGCCGCGTCTGCAACTGGTTGCACAGAGCGGCGGCCAGCATTGTGCAGGCGTGGTGGAATTCTATAGCGGTAGCCTGGGCGGTACCATTAGTTATGAAGCACAGGATAAAACACAAGATCTGGAAAACTTCCTGTGTAATAATCTGCAGTGTGGCAGCTTCCTGAAACATCTGCCGGAAACCGAAGCCGGTCGTGCACAGGATCCGGGTGAACCGCGTGAACATCAGCCGCTGCCGATTCAGTGGAAAATTCAGAATAGTAGTTGCACCAGCCTGGAACATTGCTTCCGCAAAATTAAACCGCAGAAAAGCGGCCGCGTTCTGGCCCTGCTGTGTAGCGGCTTCCAGCCGAAAGTGCAGAGTCGCCTGGTTGGCGGTAGTAGTATCTGTGAAGGTACCGTTGAAGTTCGCCAGGGTGCACAGTGGGCAGCACTGTGCGATAGTAGTAGTGCCCGCAGCAGCCTGCGCTGGGAAGAAGTGTGTCGTGAACAGCAGTGTGGCTCAGTGAATAGTTATCGCGTTCTGGATGCAGGTGATCCGACCAGTCGTGGTCTGTTCTGTCCGCATCAGAAACTGAGCCAGTGTCATGAACTGTGGGAACGTAATAGCTATTGTAAAAAAGTGTTCGTTACCTGCCAGGATCCGAATCCG

Popular Products