Products for Research Use Only

CD147 Recombinant Protein

CAT: 0384-NCP0177-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0177-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
Basigin (EMMPRIN, CD147) is a type I integral membrane receptor protein belonging to the immunoglobulin superfamily. Basigin is a glycosylated protein with four known isoforms, of which isoform 2 is the most abundantly expressed. Multiple functions have been ascribed to Basigin; foremost among these is stimulating the secretion of extracellular matrix metalloproteinases by adjacent fibroblasts, a function which has been implicated in promoting tumor progression. Research studies have shown that Basigin is overexpressed by many tumor cells, and its expression level may correlate with tumor malignancy. A recent study identified the BASIGIN gene as a regulatory target of Slug, suggesting a role for Basigin in the process of epithelial-mesenchymal transition. Basigin has also been identified as a marker for a subset of highly suppressive regulatory T cells, and as an obligate receptor for the malarial parasite Plasmodium falciparum on human erythrocytes.
CAS Number
9000-83-3
Swiss Prot
P35613
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~24kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GAACCGGGTACCGTGTTCACCACCGTTGAAGATCTGGGCAGCAAAATTCTGCTGACCTGTAGCCTGAATGATAGCGCCACCGAAGTGACCGGCCATCGTTGGCTGAAAGGCGGCGTGGTTCTGAAAGAAGATGCCCTGCCGGGTCAGAAAACCGAATTCAAAGTTGATAGCGATGATCAGTGGGGCGAATATAGCTGCGTGTTCCTGCCGGAACCGATGGGCACCGCCAATATTCAGCTGCATGGTCCGCCGCGTGTGAAAGCCGTTAAAAGTAGTGAACATATTAACGAAGGTGAAACCGCCATGCTGGTGTGTAAAAGTGAAAGTGTTCCGCCGGTGACCGATTGGGCATGGTATAAAATTACCGATAGCGAAGATAAAGCCCTGATGAATGGTAGCGAAAGTCGCTTCTTCGTTAGTAGTAGTCAGGGTCGCAGCGAACTGCATATTGAAAATCTGAATATGGAAGCCGATCCGGGCCAGTATCGCTGCAATGGTACCAGCAGTAAAGGTAGCGATCAGGCAATTATTACCCTGCGCGTTCGCAGCCATCTGGCC