CD147 Recombinant Protein

• Background:

  Basigin (EMMPRIN, CD147) is a type I integral membrane receptor protein belonging to the immunoglobulin superfamily. Basigin is a glycosylated protein with four known isoforms, of which isoform 2 is the most abundantly expressed. Multiple functions have been ascribed to Basigin; foremost among these is stimulating the secretion of extracellular matrix metalloproteinases by adjacent fibroblasts, a function which has been implicated in promoting tumor progression. Research studies have shown that Basigin is overexpressed by many tumor cells, and its expression level may correlate with tumor malignancy. A recent study identified the BASIGIN gene as a regulatory target of Slug, suggesting a role for Basigin in the process of epithelial-mesenchymal transition. Basigin has also been identified as a marker for a subset of highly suppressive regulatory T cells, and as an obligate receptor for the malarial parasite Plasmodium falciparum on human erythrocytes.

• Swiss Prot:

  P35613

• Modification Site:

  NdeI-XhoI

• Expression System:

  Pet-22b (+)

• Tag:

  His-tag

• Purity:

  Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

• Solubility:

  PBS, 4M Urea, PH7.4

• Molecular Weight:

  ~24kDa

• Storage Conditions:

  Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

• Notes:

  For research use only, not for use in diagnostic procedure.

• Host or Source:

  E.coli

• CAS Number:

  9000-83-3

• AA Sequence:

  GAACCGGGTACCGTGTTCACCACCGTTGAAGATCTGGGCAGCAAAATTCTGCTGACCTGTAGCCTGAATGATAGCGCCACCGAAGTGACCGGCCATCGTTGGCTGAAAGGCGGCGTGGTTCTGAAAGAAGATGCCCTGCCGGGTCAGAAAACCGAATTCAAAGTTGATAGCGATGATCAGTGGGGCGAATATAGCTGCGTGTTCCTGCCGGAACCGATGGGCACCGCCAATATTCAGCTGCATGGTCCGCCGCGTGTGAAAGCCGTTAAAAGTAGTGAACATATTAACGAAGGTGAAACCGCCATGCTGGTGTGTAAAAGTGAAAGTGTTCCGCCGGTGACCGATTGGGCATGGTATAAAATTACCGATAGCGAAGATAAAGCCCTGATGAATGGTAGCGAAAGTCGCTTCTTCGTTAGTAGTAGTCAGGGTCGCAGCGAACTGCATATTGAAAATCTGAATATGGAAGCCGATCCGGGCCAGTATCGCTGCAATGGTACCAGCAGTAAAGGTAGCGATCAGGCAATTATTACCCTGCGCGTTCGCAGCCATCTGGCC