DCTN3 cDNA

• Description:

  DCTN3 encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants.

• Product Name Alternative:

  DCTN-22, DCTN22

• Chromosomal Location:

  9p13

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGGGTGTACGGGCCGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTGCAGGTGGCTTTGGGGAACATTTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAGATTGAAGATCTGATCAAGTACCTGGATCCTGAGTACATCGACCGCATTGCCATACCTGATGCCTCTAAGCTGCAATTCATCCTAGCAGAGGAGCAGTTTATCCTTTCCCAGGTTGCACTCCTGGAGCAGGTGAATGCCTTGGTGCCCATGCTGGACAGTGCTCACATCAAAGCCGTTCCTGAGCATGCTGCCCGCCTGCAGCGCTTGGCCCAGATCCACATTCAGCAGCAGGACCAGTGTGTGGAAATCACTGAGGAGTCCAAGGCTCTCCTGGAGGAATACAACAAGACTACAATGCTTCTCTCCAAGCAATTCGTGCAGTGGGATGAGCTACTTTGCCAGCTAGAGGCCGCCACGCAAGTGAAGCCAGCAGAGGAGTGA

• Additionnal Information:

  DCTN3, DCTN-22, DCTN22, DCTN3, ATGD0344-10 µg, ATGD0344-20 µg, ATGD0344-50 µg, ATGD0344-100 µg, ATGD0344-250 µg, ATGD0344-500 µg, ATGD0344-1 mg, ATGD0344-10, ATGD0344-20, ATGD0344-50, ATGD0344-100, ATGD0344-250, ATGD0344-500, ATGD0344-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Signal Transduction

• Omim:

  607387

• NCBI Accession Number:

  NP_009165.1

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_007234.4

• DNA Size:

  561bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.