LAMTOR2 cDNA

• Description :

  The product of ROBLD3 is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The mouse protein interacts with MAPK scaffold protein 1, a component of the mitogen-activated protein kinase pathway. In humans, a mutation in this gene has been associated with a primary immunodeficiency syndrome, and suggests a role for this protein in endosomal biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene.

• Product Name Alternative :

  ENDAP, HSPC003, MAPBPIP, MAPKSP1AP, p14, Ragulator2, ROBLD3

• Chromosomal Location :

  1q22

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGCTGCGCCCCAAGGCTTTGACCCAGGTGCTAAGCCAAGCCAACACTGGAGGCGTCCAGAGCACCCTGCTGCTGAATAACGAGGGATCACTGCTGGCCTACTCTGGTTACGGGGACACTGACGCCCGGGTCACCGCTGCCATAGCCAGTAACATCTGGGCCGCCTACGACCGGAACGGGAACCAAGCGTTTAATGAAGACAATCTCAAATTCATCCTCATGGACTGCATGGAGGGCCGTGTAGCCATCACCCGAGTGGCCAACCTTCTGCTGTGTATGTATGCCAAGGAGACCGTGGGCTTTGGAATGCTCAAGGCCAAGGCCCAGGCTTTGGTGCAGTACCTGGAGGAGCCCCTCACCCAAGTGGCGGCATCTTAA

• Additionnal Information :

  LAMTOR2, ENDAP, HSPC003, MAPBPIP, MAPKSP1AP, p14, Ragulator2, ROBLD3, LAMTOR2, ATGD0210-10 µg, ATGD0210-20 µg, ATGD0210-50 µg, ATGD0210-100 µg, ATGD0210-250 µg, ATGD0210-500 µg, ATGD0210-1 mg, ATGD0210-10, ATGD0210-20, ATGD0210-50, ATGD0210-100, ATGD0210-250, ATGD0210-500, ATGD0210-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Signal Transduction

• Omim :

  610389

• NCBI Accession Number :

  NP_054736.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_014017.3

• DNA Size :

  378bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.