RAB35 cDNA

• Description:

  The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in the process of endocytosis and is an essential rate-limiting regulator of the fast recycling pathway back to the plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge stability and abscission, possibly by controlling phosphatidylinositol 4, 5-bis phosphate (PIP2) and SEPT2 localization at the intercellular bridge. May indirectly regulate neurite outgrowth.

• Product Name Alternative:

  H-ray, RAB1C, RAY

• Chromosomal Location:

  12q24.31

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGCCCGGGACTACGACCACCTCTTCAAGCTGCTCATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCAGACAACACTTTCTCAGGCAGCTACATCACCACGATCGGAGTGGATTTCAAGATCCGGACCGTGGAGATCAACGGGGAGAAGGTGAAGCTGCAGATCTGGGACACAGCGGGGCAGGAGCGCTTCCGCACCATCACCTCCACGTATTATCGGGGGACCCACGGGGTCATTGTGGTTTACGACGTCACCAGTGCCGAGTCCTTTGTCAACGTCAAGCGGTGGCTTCACGAAATCAACCAGAACTGTGATGATGTGTGCCGAATATTAGTGGGTAATAAGAATGACGACCCTGAGCGGAAGGTGGTGGAGACGGAAGATGCCTACAAATTCGCCGGGCAGATGGGCATCCAGTTGTTCGAGACCAGCGCCAAGGAGAATGTCAACGTGGAAGAGATGTTCAACTGCATCACGGAGCTGGTCCTCCGAGCAAAGAAAGACAACCTGGCAAAACAGCAGCAGCAACAACAGAACGATGTGGTGAAGCTCACGAAGAACAGTAAACGAAAGAAACGCTGCTGCTAA

• Additionnal Information:

  RAB35, H-ray, RAB1C, RAY, RAB35, ATGD0207-10 µg, ATGD0207-20 µg, ATGD0207-50 µg, ATGD0207-100 µg, ATGD0207-250 µg, ATGD0207-500 µg, ATGD0207-1 mg, ATGD0207-10, ATGD0207-20, ATGD0207-50, ATGD0207-100, ATGD0207-250, ATGD0207-500, ATGD0207-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Signal Transduction

• Omim:

  604199

• NCBI Accession Number:

  NP_006852.1

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_006861.6

• DNA Size:

  624bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.