GSKIP cDNA

• Description:

  GSKIP encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene.

• Product Name Alternative:

  C14orf129, HSPC210

• Chromosomal Location:

  14q32.2

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGAAACAGACTGTAATCCCATGGAGCTAAGCAGTATGTCAGGATTTGAAGAAGGTTCAGAGCTGAACGGTTTTGAAGGAACTGACATGAAAGACATGAGGCTCGAAGCTGAAGCAGTTGTAAATGATGTTCTCTTTGCTGTTAACAACATGTTTGTCTCGAAAAGCCTGCGGTGTGCGGATGATGTGGCCTATATCAATGTGGAAACAAAGGAAAGAAACAGATATTGCCTAGAACTCACTGAAGCAGGGCTCAAGGTGGTAGGCTATGCTTTTGACCAGGTAGATGATCATTTACAGACTCCCTACCATGAAACAGTCTACTCCTTGTTGGATACACTCAGCCCCGCCTACCGAGAAGCATTTGGAAACGCACTGCTTCAAAGACTGGAAGCTTTGAAAAGAGATGGACAGTCATGA

• Additionnal Information:

  GSKIP, C14orf129, HSPC210, GSKIP, ATGD0167-10 µg, ATGD0167-20 µg, ATGD0167-50 µg, ATGD0167-100 µg, ATGD0167-250 µg, ATGD0167-500 µg, ATGD0167-1 mg, ATGD0167-10, ATGD0167-20, ATGD0167-50, ATGD0167-100, ATGD0167-250, ATGD0167-500, ATGD0167-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Metabolism

• NCBI Accession Number:

  NP_057556.2

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_016472.4

• DNA Size:

  420bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.