PSMB3 cDNA

• Description :

  The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants

• Product Name Alternative :

  HC10-II

• Chromosomal Location :

  17q12

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGTCTATTATGTCCTATAACGGAGGGGCCGTCATGGCCATGAAGGGGAAGAACTGTGTGGCCATCGCTGCAGACAGGCGCTTCGGGATCCAGGCCCAGATGGTGACCACGGACTTCCAGAAGATCTTTCCCATGGGTGACCGGCTGTACATCGGTCTGGCCGGGCTCGCCACTGACGTCCAGACAGTTGCCCAGCGCCTCAAGTTCCGGCTGAACCTGTATGAGTTGAAGGAAGGTCGGCAGATCAAACCTTATACCCTCATGAGCATGGTGGCCAACCTCTTGTATGAGAAACGGTTTGGCCCTTACTACACTGAGCCAGTCATTGCCGGGTTGGACCCGAAGACCTTTAAGCCCTTCATTTGCTCTCTAGACCTCATCGGCTGCCCCATGGTGACTGATGACTTTGTGGTCAGTGGCACCTGCGCCGAACAAATGTACGGAATGTGTGAGTCCCTCTGGGAGCCCAACATGGATCCGGATCACCTGTTTGAAACCATCTCCCAAGCCATGCTGAATGCTGTGGACCGGGATGCAGTGTCAGGCATGGGAGTCATTGTCCACATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGACTAA

• Additionnal Information :

  PSMB3, HC10-II, PSMB3, ATGD0163-10 µg, ATGD0163-20 µg, ATGD0163-50 µg, ATGD0163-100 µg, ATGD0163-250 µg, ATGD0163-500 µg, ATGD0163-1 mg, ATGD0163-10, ATGD0163-20, ATGD0163-50, ATGD0163-100, ATGD0163-250, ATGD0163-500, ATGD0163-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Ubiquitination

• Omim :

  602176

• NCBI Accession Number :

  NP_002786.2

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_002795.3

• DNA Size :

  618bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.