CENPA cDNA

• Description :

  Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. CENPA encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. CENPA is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4) 2 tetrameric core of the nucleosome particle. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

• Product Name Alternative :

  CenH3, CENP-A

• Chromosomal Location :

  2p23.3

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGGGCCCGCGCCGCCGGAGCCGAAAGCCCGAGGCCCCGAGGAGGCGCAGCCCGAGCCCGACCCCGACCCCCGGCCCCTCCCGGCGGGGCCCCTCCTTAGGCGCTTCCTCCCATCAACACAGTCGGCGGAGACAAGGTTGGCTAAAGGAGATCCGAAAGCTTCAGAAGAGCACACACCTCTTGATAAGGAAGCTGCCCTTCAGCCGCCTGGCAAGAGAAATATGTGTTAAATTCACTCGTGGTGTGGACTTCAATTGGCAAGCCCAGGCCCTATTGGCCCTACAAGAGGCAGCAGAAGCATTTCTAGTTCATCTCTTTGAGGACGCCTATCTCCTCACCTTACATGCAGGCCGAGTTACTCTCTTCCCAAAGGATGTGCAACTGGCCCGGAGGATCCGGGGCCTTGAGGAGGGACTCGGCTGA

• Additionnal Information :

  CENPA, CenH3, CENP-A, CENPA, ATGD0147-10 µg, ATGD0147-20 µg, ATGD0147-50 µg, ATGD0147-100 µg, ATGD0147-250 µg, ATGD0147-500 µg, ATGD0147-1 mg, ATGD0147-10, ATGD0147-20, ATGD0147-50, ATGD0147-100, ATGD0147-250, ATGD0147-500, ATGD0147-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Epigenetics and Nuclear Signaling

• Omim :

  117139

• NCBI Accession Number :

  NP_001800.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_001809.3

• DNA Size :

  423bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.