BAGE

CAT: 0399-CSB-CL621646HUSize: 10 μg Plasmid + 200 μL GlycerolDry Ice: NoHazardous: No

CAT#:0399-CSB-CL621646HUSize:10 μg Plasmid + 200 μL Glycerol

Selected

PRICE

AVAILABILITY

24/48H Stock Items & 2 to 6 Weeks non Stock Items.

1 / 1

Sequence

ATGGCGGCCAGAGCGGTTTTTCTGGCATTGTCTGCCCAGCTGCTCCAAGCCAGGCTGATGAAGGAGGAGTCCCCTGTGGTGAGCTGGAGGTTGGAGCCTGAAGACGGCACAGCTCTGTGCTTCATCTTCTGA

Length

132

Related Products

Catalog	Name
CSB-YP864372MO-01	Recombinant Mouse BAG family molecular chaperone regulator 3 (Bag3)
CSB-EP890743HU-01	Recombinant Human BAG family molecular chaperone regulator 5 (BAG5)
CSB-EP002530HU-01	Recombinant Human BAG family molecular chaperone regulator 2 (BAG2)
CSB-EP864372MO-01	Recombinant Mouse BAG family molecular chaperone regulator 3 (Bag3)
CSB-CL002531HU1	BAG3
CSB-CL768236HU	BAGE3
CSB-CL002530HU	BAG2
CSB-CL859527HU	BAG1
CSB-CL002531HU2	BAG3
CSB-CL890743HU	BAG5

Alternative Products

Catalog	Name
abx266080-01	BAGE Peptide
E40PV547	BAGE Antibody
M42016-01	BAGE (2 - 10)
MBS8246137-01	BAGE (2-10)
5-00745	BAGE (2 - 10)
sc-91415	BAGE siRNA (h)
12987051	BAGE Adenovirus (Human)
MBS8226874-01	BAGE siRNA (Human)
abx908851-01	Human BAGE siRNA
E-PP-0744-01	BAGE (2-10)

Popular Products

Top 4 types of cancer (colon, breast, lung and prosate) with normal tissue array, including colon adenocarcinoma, breast invasive carcinoma of no special type, prostate adenocarcinoma, lung squamous cell carcinoma, lung adenocarcinoma, grade, TNM and clinical state (AJCC 8.0), 24 cases/24 cores (core size 1.5mm) ï¼Œreplacing TP242eï¼ŒRecent Year Collection
SKU: TP242f|Size: 1 Each
Donkey Anti-Bovine IgG (H+L) aff pure (adsorbed with Hamster, human, mouse, rat serum)
SKU: 80545-UL|Size: 0.5 mg
Donkey Anti-Bovine IgG (H+L) aff pure (adsorbed with Hamster, human, mouse, rat serum)
SKU: 80545-HP|Size: 0.5 mg
Goat anti-Rat IgG (H&L) - Affinity Pure,TRITC Conjugate, min x w/bovine, goat, hamster, horse, human, mouse or rabbit IgG/serum
SKU: MBS686180-01|Size: 1 mg
Goat anti-Rat IgG (H&L) - Affinity Pure, Biotin Conjugate, min x w/Bovine, Goat, Hamster, Horse, Human, Mouse, Rabbit IgG/Serum
SKU: MBS686219-01|Size: 1 mg
Goat anti-Rat IgG (H&L) - Affinity Pure, DyLight633 Conjugate min x w/bovine, goat, hamster, horse, human, mouse or rabbit IgG/serum
SKU: MBS686258-01|Size: 1 mg
Goat anti-Rat IgG (H&L) - Affinity Pure, min x w/Bovine, Goat, Hamster, Horse, Human, Mouse, Rabbit IgG/Serum
SKU: MBS686377-01|Size: 1 mg
Goat anti-Rat IgG (H&L) - Affinity Pure, HRP Conjugate, min x w/Bovine, Goat, Hamster, Horse, Human, Mouse, Rabbit IgG/Serum
SKU: MBS686401-01|Size: 1 mg
Goat anti-Guinea Pig IgG (H&L) - Affinity Pure, DyLight488 Conjugate, min w/bovine, chicken, goat, hamster, horse, human, mouse, rabbit, rat, sheep Serum
SKU: MBS687157-01|Size: 1 mg
Goat anti-Guinea Pig IgG (H&L) - Affinity Pure, DyLight800 Conjugate, min w/bovine, chicken, goat, hamster, horse, human, mouse, rabbit, rat, sheep Serum
SKU: MBS687815-01|Size: 1 mg