CD48 cloning plasmid
-
Catalog numberCSB-CL004941HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CD48 gene.
-
SpecificationsGene name: CD48; Gene ID: 962; Accession number: BC016182; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 732; Sequence: atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggttttatactttcgaccagaagattgtagaatgggattccagaaaatctaagtactttgaatccaaatttaaaggcagggtcagacttgatcctcagagtggcgcactgtacatctctaaggtccagaaagaggacaacagcacctacatcatgagggtgttgaaaaagactgggaatgagcaagaatggaagatcaagctgcaagtgcttgaccctgtacccaagcctgtcatcaaaattgagaagatagaagacatggatgacaactgttatttgaaactgtcatgtgtgatacctggcgagtctgtaaactacacctggtatggggacaaaaggcccttcccaaaggagctccagaacagtgtgcttgaaaccacccttatgccacataattactccaggtgttatacttgccaagtcagcaattctgtgagcagcaagaatggcacggtctgcctcagtccaccctgtaccctggcccggtcctttggagtagaatggattgcaagttggctagtggtcacggtgcccaccattcttggcctgttacttacctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCD48
-
Short nameCD48 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameCD48 molecule cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetCD48 molecule, BCM1 and BLAST and BLAST1 and hCD48 and mCD48 and MEM-102 and SLAMF2, CD48 and IDBG-104080 and ENSG00000117091 and 962, protein binding, Cell surfaces, Cd48 and IDBG-204791 and ENSMUSG00000015355 and 12506, CD48 and IDBG-630526 and ENSBTAG00000011238 and 508386
-
Gene info
-
Identity
-
Gene
-
Long gene nameCD48 molecule
-
Synonyms gene
-
Synonyms gene name
- CD48 antigen (B-cell membrane protein)
- CD48 molecule
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- V-set domain containing
- CD molecules
-
VEGA ID
MeSH Data
-
Name
-
ConceptScope note: The number of CD4-POSITIVE T-LYMPHOCYTES per unit volume of BLOOD. Determination requires the use of a fluorescence-activated flow cytometer.
-
Tree numbers
- E01.370.225.500.195.107.595.500.150
- E01.370.225.625.107.595.500.150
- E05.200.500.195.107.595.500.150
- E05.200.625.107.595.500.150
- E05.242.195.107.595.500.150
-
Qualifiersethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data