CD48 cloning plasmid

• Catalog number
  CSB-CL004941HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CD48 gene.
• Specifications
  Gene name: CD48; Gene ID: 962; Accession number: BC030224; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 510; Sequence: atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggttttatactttcgaccagaagattgtagaatgggattccagaaaatctaagtactttgaatccaaatttaaaggcagggtcagacttgatcctcagagtggcgcactgtacatctctaaggtccagaaagaggacaacagcacctacatcatgagggtgttgaaaaagactgggaatgagcaagaatggaagatcaagctgcaagtgcttggtgagtcaggggagccaaagagcaaatccccactccagtggccccagatggaccactgtagggcttcctgggaggcatggggcactctcggggaggaggagagaaaaacctcaggacaggtttga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CD48   cloning  
• Gene symbol
  CD48
• Short name
  CD48 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  CD48 molecule cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CD48 molecule, BCM1 and BLAST and BLAST1 and hCD48 and mCD48 and MEM-102 and SLAMF2, CD48 and IDBG-104080 and ENSG00000117091 and 962, protein binding, Cell surfaces, Cd48 and IDBG-204791 and ENSMUSG00000015355 and 12506, CD48 and IDBG-630526 and ENSBTAG00000011238 and 508386

Gene info

• Identity
  HGNC:1683
• Gene
  CD48
• Long gene name
  CD48 molecule
• Synonyms gene
  • BCM1
• Synonyms gene name
  • CD48 antigen (B-cell membrane protein)
  • CD48 molecule
• Synonyms
  • BLAST
  • mCD48
  • hCD48
  • SLAMF2
• GenBank acession
  • BC016182
• Locus
  1q23.3
• Discovery year
  1986-01-01
• Entrez gene record
  962
• Pubmed identfication
  • 2828034
• RefSeq identity
  • NM_001778
• Classification
  • V-set domain containing
  • CD molecules
• VEGA ID
  OTTHUMG00000024009

MeSH Data

• Name
  CD4 Lymphocyte Count
• Concept
  Scope note: The number of CD4-POSITIVE T-LYMPHOCYTES per unit volume of BLOOD. Determination requires the use of a fluorescence-activated flow cytometer.
• Tree numbers
  • E01.370.225.500.195.107.595.500.150
  • E01.370.225.625.107.595.500.150
  • E05.200.500.195.107.595.500.150
  • E05.200.625.107.595.500.150
  • E05.242.195.107.595.500.150
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Similar products