CD69 Recombinant Protein

CAT:
384-NCP0222-01
Size:
500 µg
  • Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
  • Dry Ice Shipment: No
CD69 Recombinant Protein - image 1

CD69 Recombinant Protein

  • Background :

    CD69, also known as Leu-23, is a type II transmembrane glycoprotein that is expressed on the surface of T cells, B cells, and NK cells. This phosphorylated disulfide-linked 28 to 32-kDa homodimer is constitutively expressed on a subset of thymocytes and platelets. It also acts as an activation antigen of lymphocytes, NK cells, neutrophils, and eosinophils. Studies have shown that stimulation of the T cell receptor (TCR) increases the expression of CD69 on the cell surface. The ability to detect the level of CD69 expression after TCR activation makes CD69 an ideal indicator of T cell activation. The FN50 antibody is widely used as a marker for T cell activation.
  • Swiss Prot :

    Q07108
  • Modification Site :

    NdeI-XhoI
  • Expression System :

    Pet-22b (+)
  • Tag :

    His-tag
  • Purity :

    Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
  • Solubility :

    PBS, 4M Urea, PH7.4
  • Molecular Weight :

    ~17kDa
  • Storage Conditions :

    Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
  • Notes :

    For research use only, not for use in diagnostic procedure.
  • Host or Source :

    E.coli
  • CAS Number :

    9000-83-3
  • AA Sequence :

    AGCGTTGGTCAGTATAATTGTCCGGGTCAGTATACCTTCAGCATGCCGAGTGATAGCCATGTGAGTAGTTGTAGTGAAGATTGGGTGGGTTATCAGCGCAAATGCTACTTCATTAGCACCGTGAAACGCAGCTGGACCAGTGCACAGAATGCCTGCAGTGAACATGGCGCCACCCTGGCAGTGATTGATAGCGAAAAAGATATGAACTTCCTGAAACGTTATGCCGGTCGCGAAGAACATTGGGTTGGTCTGAAAAAAGAACCGGGTCATCCGTGGAAATGGAGTAATGGCAAAGAATTCAATAACTGGTTCAATGTTACCGGCAGTGATAAATGCGTGTTCCTGAAAAATACCGAAGTGAGTAGTATGGAATGTGAAAAAAATCTGTACTGGATCTGTAATAAGCCGTATAAA

Featured Selection

Popular Products

Discover our most sought-after biotechnology products, trusted by researchers worldwide