CD69 Recombinant Protein
- Availability: 24/48H Stock Items & 2 to 6 Weeks non Stock Items.
- Dry Ice Shipment: No


CD69 Recombinant Protein
Background :
CD69, also known as Leu-23, is a type II transmembrane glycoprotein that is expressed on the surface of T cells, B cells, and NK cells. This phosphorylated disulfide-linked 28 to 32-kDa homodimer is constitutively expressed on a subset of thymocytes and platelets. It also acts as an activation antigen of lymphocytes, NK cells, neutrophils, and eosinophils. Studies have shown that stimulation of the T cell receptor (TCR) increases the expression of CD69 on the cell surface. The ability to detect the level of CD69 expression after TCR activation makes CD69 an ideal indicator of T cell activation. The FN50 antibody is widely used as a marker for T cell activation.Swiss Prot :
Q07108Modification Site :
NdeI-XhoIExpression System :
Pet-22b (+)Tag :
His-tagPurity :
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .Solubility :
PBS, 4M Urea, PH7.4Molecular Weight :
~17kDaStorage Conditions :
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.Notes :
For research use only, not for use in diagnostic procedure.Host or Source :
E.coliCAS Number :
9000-83-3AA Sequence :
AGCGTTGGTCAGTATAATTGTCCGGGTCAGTATACCTTCAGCATGCCGAGTGATAGCCATGTGAGTAGTTGTAGTGAAGATTGGGTGGGTTATCAGCGCAAATGCTACTTCATTAGCACCGTGAAACGCAGCTGGACCAGTGCACAGAATGCCTGCAGTGAACATGGCGCCACCCTGGCAGTGATTGATAGCGAAAAAGATATGAACTTCCTGAAACGTTATGCCGGTCGCGAAGAACATTGGGTTGGTCTGAAAAAAGAACCGGGTCATCCGTGGAAATGGAGTAATGGCAAAGAATTCAATAACTGGTTCAATGTTACCGGCAGTGATAAATGCGTGTTCCTGAAAAATACCGAAGTGAGTAGTATGGAATGTGAAAAAAATCTGTACTGGATCTGTAATAAGCCGTATAAA

