Products for Research Use Only
RegisterLogin

CD69 Recombinant Protein

CAT: 0384-NCP0222-01Size: 500 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0384-NCP0222-01Size:500 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Background
CD69, also known as Leu-23, is a type II transmembrane glycoprotein that is expressed on the surface of T cells, B cells, and NK cells. This phosphorylated disulfide-linked 28 to 32-kDa homodimer is constitutively expressed on a subset of thymocytes and platelets. It also acts as an activation antigen of lymphocytes, NK cells, neutrophils, and eosinophils. Studies have shown that stimulation of the T cell receptor (TCR) increases the expression of CD69 on the cell surface. The ability to detect the level of CD69 expression after TCR activation makes CD69 an ideal indicator of T cell activation. The FN50 antibody is widely used as a marker for T cell activation.
CAS Number
9000-83-3
Swiss Prot
Q07108
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~17kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
AGCGTTGGTCAGTATAATTGTCCGGGTCAGTATACCTTCAGCATGCCGAGTGATAGCCATGTGAGTAGTTGTAGTGAAGATTGGGTGGGTTATCAGCGCAAATGCTACTTCATTAGCACCGTGAAACGCAGCTGGACCAGTGCACAGAATGCCTGCAGTGAACATGGCGCCACCCTGGCAGTGATTGATAGCGAAAAAGATATGAACTTCCTGAAACGTTATGCCGGTCGCGAAGAACATTGGGTTGGTCTGAAAAAAGAACCGGGTCATCCGTGGAAATGGAGTAATGGCAAAGAATTCAATAACTGGTTCAATGTTACCGGCAGTGATAAATGCGTGTTCCTGAAAAATACCGAAGTGAGTAGTATGGAATGTGAAAAAAATCTGTACTGGATCTGTAATAAGCCGTATAAA

Related Products

CatalogName
BS48337-01CD69 Recombinant Rabbit mAb
BS48345CD69 Recombinant Rabbit mAb
BS6554-01CD69 polyclonal antibody
NCP0219-01CD63 Recombinant Protein
NCP0221-01CD68 Recombinant Protein
NCP0218-01CD6 Recombinant Protein
NCP0220-01CD66/CEACAM1 Recombinant Protein
NBP0425Recombinant Protein A Protein
NBP0426Recombinant Protein G Protein
NCP0391-01Protein-G Recombinant Protein

Alternative Products

CatalogName
OPCD02253-10UGCD69 Recombinant Protein
PROTQ07108-01Human CD69 Recombinant Protein
MBS9146798-01Recombinant Mouse CD69 Protein
MBS8304948-01Recombinant Human CD69 Protein
PPT-16424Mouse CD69 Recombinant Protein
TP727752CD69 Human Recombinant Protein
RP122675CD69 Recombinant Protein (Mouse)
RP194012CD69 Recombinant Protein (Rat)
NBP2-37926PEPCD69 Recombinant Protein Antigen
abx658189-01Rat CD69 (CD69) Protein

Popular Products