CD178 Recombinant Protein

CAT: 0384-NCP0183-01Size: 500 µgDry Ice: NoHazardous: No
CAT#:0384-NCP0183-01Size:500 µg
Selected
PRICE
AVAILABILITY: InStock
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Product image 1
1 / 1
Background
Association of the receptor Fas with its ligand FasL triggers an apoptotic pathway that plays an important role in immune regulation, development, and progression of cancers. Loss of function mutation in either Fas (lpr mice) or FasL (gld mice) leads to lymphadenopathy and splenomegaly as a result of decreased apoptosis in CD4-CD8- T lymphocytes. FasL (CD95L, Apo-1L) is a type II transmembrane protein of 280 amino acids (runs at approximately 40 kDa upon glycosylation) that belongs to the TNF family, which also includes TNF-α, TRAIL, and TWEAK. Binding of FasL to its receptor triggers the formation of a death-inducing signaling complex (DISC) involving the recruitment of the adaptor protein FADD and caspase-8. Activation of caspase-8 from this complex initiates a caspase cascade resulting in the activation of caspase-3 and subsequent cleavage of proteins leading to apoptosis. Unlike Fas, which is constitutively expressed by various cell types, FasL is predominantly expressed on activated T lymphocytes, NK cells, and at immune privileged sites. FasL is also expressed in several tumor types as a mechanism to evade immune surveillance. Similar to other members of the TNF family, FasL can be cleaved by metalloproteinases producing a 26 kDa trimeric soluble form.
CAS Number
9000-83-3
Swiss Prot
P48023
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~20kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CAGCTGTTCCATCTGCAGAAAGAACTGGCAGAACTGCGTGAAAGTACCAGCCAGATGCATACCGCAAGCAGTCTGGAAAAACAGATTGGCCATCCGAGCCCGCCGCCGGAAAAAAAAGAACTGCGCAAAGTTGCCCATCTGACCGGCAAAAGTAATAGTCGCAGTATGCCGCTGGAATGGGAAGATACCTATGGCATTGTGCTGCTGAGCGGTGTGAAATATAAAAAAGGCGGCCTGGTTATTAATGAAACCGGCCTGTACTTCGTGTATAGTAAAGTGTACTTCCGTGGTCAGAGCTGCAATAATCTGCCGCTGAGTCATAAAGTGTATATGCGTAATAGTAAGTACCCGCAGGATCTGGTTATGATGGAAGGTAAAATGATGAGTTATTGTACCACCGGTCAGATGTGGGCCCGCAGTAGCTATCTGGGTGCCGTGTTCAATCTGACCAGTGCCGATCATCTGTATGTGAATGTTAGCGAACTGAGCCTGGTTAACTTCGAAGAAAGCCAGACCTTCTTCGGCCTGTATAAACTG

Related Products

CatalogName
MB65758-01CD178 monoclonal antibody
NCP0183P-01CD178 polyclonal antibody
CEK1073Human CD178 ELISA Kit
NCP0180-01CD158 Recombinant Protein
NCP0292-01CD170 Recombinant Protein
NCP0352-01CD174 Recombinant Protein
NCP0264-01CD138 Recombinant Protein
NCP0254-01CD118 Recombinant Protein
NBP0515Recombinant human CD138 protein
NCP0182-01CD171/N-CAML1 Recombinant Protein

Alternative Products

CatalogName
E43CP0183CD178 Recombinant Protein
TD-ATMP00374HURecombinant Human CD178 protein
PPT-11249Human CD178/FASLG/TNFSF6 Recombinant Protein
RP02829-01Recombinant Mouse TNFSF6/FAS ligand/CD178 Protein
KMH360Recombinant Human CD178/FASLG Protein, His Tag
RP02353-01Recombinant Human TNFSF6/FAS ligand/CD178 Protein
YHE54301Recombinant Human CD178/FASLG/TNFSF6 Protein, N-His
AHE54301Recombinant Human CD178/FASLG/TNFSF6 Protein, N-His (Active)
AME54301Recombinant Mouse CD178/FASLG/TNFSF6 Protein, N-His (Active)
E902353PRecombinant Human Fas ligand/APTL/CD95 ligand/CD178 Protein

Popular Products