RPL32 cDNA

• Description:

  RPL32 is a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. RPL32 is located in the cytoplasm. Although some studies have mapped this gene to 3q13. 3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for RPL32.

• Product Name Alternative:

  L32, PP9932

• Chromosomal Location:

  3p25-p24

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGATCGTCAAAAAGAGAACCAAGAAGTTCATCCGGCACCAGTCAGACCGATATGTCAAAATTAAGCGTAACTGGCGGAAACCCAGAGGCATTGACAACAGGGTTCGTAGAAGATTCAAGGGCCAGATCTTGATGCCCAACATTGGTTATGGAAGCAACAAAAAAACAAAGCACATGCTGCCCAGTGGCTTCCGGAAGTTCCTGGTCCACAACGTCAAGGAGCTGGAAGTGCTGCTGATGTGCAACAAATCTTACTGTGCCGAGATCGCTCACAATGTTTCCTCCAAGAACCGCAAAGCCATCGTGGAAAGAGCTGCCCAACTGGCCATCAGAGTCACCAACCCCAATGCCAGGCTGCGCAGTGAAGAAAATGAGTAG

• Additionnal Information:

  RPL32, L32, PP9932, RPL32, ATGD0480-10 µg, ATGD0480-20 µg, ATGD0480-50 µg, ATGD0480-100 µg, ATGD0480-250 µg, ATGD0480-500 µg, ATGD0480-1 mg, ATGD0480-10, ATGD0480-20, ATGD0480-50, ATGD0480-100, ATGD0480-250, ATGD0480-500, ATGD0480-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Epigenetics and Nuclear Signaling

• NCBI Accession Number:

  NP_001007075.1

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_001007074.1

• DNA Size:

  408bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.