RPS10 cDNA

• Description :

  RPS10 is a ribosomal protein that is a component of the 40S subunit and belongs to the S10E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. Alternate splicing results in multiple transcript variants that encode the same protein.

• Product Name Alternative :

  DBA9, S10

• Chromosomal Location :

  6p21.31

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGTTGATGCCTAAGAAGAACCGGATTGCCATTTATGAACTCCTTTTTAAGGAGGGAGTCATGGTGGCCAAGAAGGATGTCCACATGCCTAAGCACCCGGAGCTGGCAGACAAGAATGTGCCCAACCTTCATGTCATGAAGGCCATGCAGTCTCTCAAGTCCCGAGGCTACGTGAAGGAACAGTTTGCCTGGAGACATTTCTACTGGTACCTTACCAATGAGGGTATCCAGTATCTCCGTGATTACCTTCATCTGCCCCCGGAGATTGTGCCTGCCACCCTACGCCGTAGCCGTCCAGAGACTGGCAGGCCTCGGCCTAAAGGTCTGGAGGGTGAGCGACCTGCGAGACTCACAAGAGGGGAAGCTGACAGAGATACCTACAGACGGAGTGCTGTGCCACCTGGTGCCGACAAGAAAGCCGAGGCTGGGGCTGGGTCAGCAACCGAATTCCAGTTTAGAGGCGGATTTGGTCGTGGACGTGGTCAGCCACCTCAGTAA

• Additionnal Information :

  RPS10, DBA9, S10, RPS10, ATGD0402-10 µg, ATGD0402-20 µg, ATGD0402-50 µg, ATGD0402-100 µg, ATGD0402-250 µg, ATGD0402-500 µg, ATGD0402-1 mg, ATGD0402-10, ATGD0402-20, ATGD0402-50, ATGD0402-100, ATGD0402-250, ATGD0402-500, ATGD0402-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Epigenomics (Transcription & Translation)

• Omim :

  603632

• NCBI Accession Number :

  NP_001190174.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_001203245.2

• DNA Size :

  498bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.